RALGPS1 cdna clone
RALGPS1 cDNA Clone
Gene Names
RALGPS1; RALGEF2; RALGPS1A
Synonyms
RALGPS1; RALGPS1 cDNA Clone; RALGPS1 cdna clone
Sequence
atgtacaagaggaatggtctgatggctagcgtgttggtcacctctgccactccacagggcagcagcagctcggactctctggagggccagagctgcgactatgccagcaagagctatgatgccgttgtcttcgatgttttgaaagtgaccccagaggagtttgctagccagattacattaatggatatacctgtgtttaaagctatccagccggaggaactagccagctgtggatggagtaagaaggagaaacacagtcttgcccctaacgttgtggcctttacccggaggtttaaccaggtcagtttttgggttgtacgagaaattctaacagcacagactttaaaaataagggcagaaatcctcagccattttgtgaaaatagccaagaaacttctagaactcaacaaccttcattctctcatgtctgtggtatcagcattacaaagtgctcccatcttcaggctgacaaaaacctgggctcttttaaatcgaaaagacaagactacctttgagaaattggactacctgatgtcgaaagaagataattacaagcggacacgggaatatatccgaagcttgaagatggttccaagtattccctatctaggaatctatcttctggatttaatctacattgattctgcatatcctgcctcaggcagtatcatggaaaatgaacaaagatccaatcagatgaacaatattcttcgaataattgctgatttacaagtttcctgcagctatgatcacctcaccaccctgccccatgtgcagaagtacctgaagtccgtacgctacattgaagagctccagaagtttgtggaagacgacaactacaaactgtcgctcagaatcgaaccaggaagcagctctccaagactagtctcttccaaggaagatcttgcagtctcccatctcagcagcctgtcacatcaaggtcaagcagaagaggcaagactcaaacccacctctggccaacaccctgcctggatgtggcccagctcctcacgagtaccagcggctcccccagcatctgctgctccgcgctccccgtggcctaggaatctaagaaatgatcaaggtcaaccaggtgcagtggctctcacctgtaatcccagcactttgggaagccgaagcaggaggatcacttga
Sequence Length
1155
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,865 Da
NCBI Official Full Name
Homo sapiens Ral GEF with PH domain and SH3 binding motif 1, mRNA
NCBI Official Synonym Full Names
Ral GEF with PH domain and SH3 binding motif 1
NCBI Official Symbol
RALGPS1
NCBI Official Synonym Symbols
RALGEF2; RALGPS1A
NCBI Protein Information
ras-specific guanine nucleotide-releasing factor RalGPS1
UniProt Protein Name
Ras-specific guanine nucleotide-releasing factor RalGPS1
Protein Family
UniProt Gene Name
RALGPS1
UniProt Synonym Gene Names
KIAA0351; RALGEF2; RalGEF 2
UniProt Entry Name
RGPS1_HUMAN
Uniprot Description
RALGPS1: Guanine nucleotide exchange factor (GEF) for the small GTPase RALA. May be involved in cytoskeletal organization. Guanine nucleotide exchange factor for. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs, misc.; GEFs
Chromosomal Location of Human Ortholog: 9q33.3
Molecular Function: Ral guanyl-nucleotide exchange factor activity
Biological Process: regulation of Ral protein signal transduction
Research Articles on RALGPS1
Similar Products
Product Notes
The RALGPS1 ralgps1 (Catalog #AAA1275409) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaaga ggaatggtct gatggctagc gtgttggtca cctctgccac tccacagggc agcagcagct cggactctct ggagggccag agctgcgact atgccagcaa gagctatgat gccgttgtct tcgatgtttt gaaagtgacc ccagaggagt ttgctagcca gattacatta atggatatac ctgtgtttaa agctatccag ccggaggaac tagccagctg tggatggagt aagaaggaga aacacagtct tgcccctaac gttgtggcct ttacccggag gtttaaccag gtcagttttt gggttgtacg agaaattcta acagcacaga ctttaaaaat aagggcagaa atcctcagcc attttgtgaa aatagccaag aaacttctag aactcaacaa ccttcattct ctcatgtctg tggtatcagc attacaaagt gctcccatct tcaggctgac aaaaacctgg gctcttttaa atcgaaaaga caagactacc tttgagaaat tggactacct gatgtcgaaa gaagataatt acaagcggac acgggaatat atccgaagct tgaagatggt tccaagtatt ccctatctag gaatctatct tctggattta atctacattg attctgcata tcctgcctca ggcagtatca tggaaaatga acaaagatcc aatcagatga acaatattct tcgaataatt gctgatttac aagtttcctg cagctatgat cacctcacca ccctgcccca tgtgcagaag tacctgaagt ccgtacgcta cattgaagag ctccagaagt ttgtggaaga cgacaactac aaactgtcgc tcagaatcga accaggaagc agctctccaa gactagtctc ttccaaggaa gatcttgcag tctcccatct cagcagcctg tcacatcaag gtcaagcaga agaggcaaga ctcaaaccca cctctggcca acaccctgcc tggatgtggc ccagctcctc acgagtacca gcggctcccc cagcatctgc tgctccgcgc tccccgtggc ctaggaatct aagaaatgat caaggtcaac caggtgcagt ggctctcacc tgtaatccca gcactttggg aagccgaagc aggaggatca cttga. It is sometimes possible for the material contained within the vial of "RALGPS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
