Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZXDC cdna clone

ZXDC cDNA Clone

Gene Names
ZXDC; ZXDL
Synonyms
ZXDC; ZXDC cDNA Clone; ZXDC cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcgcacatggtcagacagcacagccggcgccaagatctcttacctcagctagaagctccgagttctcttactcccagcagtgaactcagcagcccaggccaaagtgagctcactaacatggatcttgctgcactcttctctgacacacctgccaatgctagtggttctgcaggtgggtcggatgaggctctgaactccggaatcctgactattgacgtcacttctgtgagctcctctctgggagggaacctccctgctaataatagctccctagggccgatggaacccctggtcctggtggcccacagtgatattcccccaagcctggacagccctctggttctcgggacagcagccacggttctgcagcagggcagcttcagtgtggatgacgtgcagactgtgagtgcaggagcattaggctgtctggtggctctgcccatgaagaacttgagtgacgacccactggctttgacctccaatagtaacttagcagcacatatcaccacaccgacctcttcgagcaccccccgagaaaatgccagtgtcccggaactgctggctccaatcaaggtggagccggactcgccttctcgcccaggagcagttgggcagcaggaaggaagccatgggctgccccagtccacgttgcccagtccagcagagcagcacggtgcccaggacacagagctcagtgcaggcactggcaacttctatttggaaagtgggggctcagcaagaactgattaccgagccattcaactagccaaggaaaaaaagcagagaggagcggggagcaatgcaggagcctcacagtctactcagagaaaaataaaagaaggcaaaatgagtcctccccatttccatgcaagccagaacagttggttgtgtgggagcctcgtggtgcccagcggaggacggccaggaccagctccagcagctggggtgcagtgcggggcgcagggcgtccaggtccagctggtgcaggatgacccctccggcgaaggtgtcctgccctcggcccgcggcccagccaccttcctccccttcctcactgtggacctgcccgtctacgtcctccaggaggtgctcccctcatctggaggccctgctggaccggaggccacccagttcccaggaagcactatcaacctgcaggatctgcagtga
Sequence Length
1176
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,685 Da
NCBI Official Full Name
Homo sapiens ZXD family zinc finger C, mRNA
NCBI Official Synonym Full Names
ZXD family zinc finger C
NCBI Official Symbol
ZXDC
NCBI Official Synonym Symbols
ZXDL
NCBI Protein Information
zinc finger protein ZXDC
UniProt Protein Name
Zinc finger protein ZXDC
Protein Family
UniProt Gene Name
ZXDC
UniProt Synonym Gene Names
ZXDL
UniProt Entry Name
ZXDC_HUMAN

Uniprot Description

ZXDC: Cooperates with CIITA to promote transcription of MHC class I and MHC class II genes. Belongs to the ZXD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 3q21.3

Molecular Function: LRR domain binding; protein binding; transcription factor activity

Biological Process: positive regulation of transcription, DNA-dependent

Research Articles on ZXDC

Similar Products

Product Notes

The ZXDC zxdc (Catalog #AAA1275350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcgc acatggtcag acagcacagc cggcgccaag atctcttacc tcagctagaa gctccgagtt ctcttactcc cagcagtgaa ctcagcagcc caggccaaag tgagctcact aacatggatc ttgctgcact cttctctgac acacctgcca atgctagtgg ttctgcaggt gggtcggatg aggctctgaa ctccggaatc ctgactattg acgtcacttc tgtgagctcc tctctgggag ggaacctccc tgctaataat agctccctag ggccgatgga acccctggtc ctggtggccc acagtgatat tcccccaagc ctggacagcc ctctggttct cgggacagca gccacggttc tgcagcaggg cagcttcagt gtggatgacg tgcagactgt gagtgcagga gcattaggct gtctggtggc tctgcccatg aagaacttga gtgacgaccc actggctttg acctccaata gtaacttagc agcacatatc accacaccga cctcttcgag caccccccga gaaaatgcca gtgtcccgga actgctggct ccaatcaagg tggagccgga ctcgccttct cgcccaggag cagttgggca gcaggaagga agccatgggc tgccccagtc cacgttgccc agtccagcag agcagcacgg tgcccaggac acagagctca gtgcaggcac tggcaacttc tatttggaaa gtgggggctc agcaagaact gattaccgag ccattcaact agccaaggaa aaaaagcaga gaggagcggg gagcaatgca ggagcctcac agtctactca gagaaaaata aaagaaggca aaatgagtcc tccccatttc catgcaagcc agaacagttg gttgtgtggg agcctcgtgg tgcccagcgg aggacggcca ggaccagctc cagcagctgg ggtgcagtgc ggggcgcagg gcgtccaggt ccagctggtg caggatgacc cctccggcga aggtgtcctg ccctcggccc gcggcccagc caccttcctc cccttcctca ctgtggacct gcccgtctac gtcctccagg aggtgctccc ctcatctgga ggccctgctg gaccggaggc cacccagttc ccaggaagca ctatcaacct gcaggatctg cagtga. It is sometimes possible for the material contained within the vial of "ZXDC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.