Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP13A1 cdna clone

ATP13A1 cDNA Clone

Gene Names
ATP13A1; ATP13A; CGI-152
Synonyms
ATP13A1; ATP13A1 cDNA Clone; ATP13A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtggggatggcaccaacgacgtgggcgccctgaagcatgctgacgtgggtgtggcgctcttggccaatgcccctgagcgggttgtcgagcggcgacggcggccccgggacagcccaaccctgagcaacagtggcatcagagccacctccaggacagccaagcagcggtcggggctccctccctccgaggagcagccaacctcccagagggaccgcctgagccaggtgctgcgagacctcgaggacgagagtacgcccattgtgaaactgggggatgccagcatcgcagcacccttcacctccaagctctcatccatccagtgcatctgccacgtgatcaagcagggccgctgcacgctggtgaccacgctacagatgttcaagatcctggcgctcaatgccctcatcctggcctacagccagagcgtcctctacctggagggagtcaagttcagtgacttccaggccaccctacaggggctgctgctggccggctgcttcctcttcatctcccgttccaagcccctcaagaccctctcccgagaacggcccctgcccaacatcttcaacctgtacaccatcctcaccgtcatgctccagttctttgtgcacttcctgagccttgtctacctgtaccgtgaggcccaggcccggagccccgagaagcaggagcagttcgtggacttgtacaaggagtttgagccaagcctggtcaacagcaccgtctacatcatggccatggccatgcagatggccaccttcgccatcaattacaaaggcccgcccttcatggagagcctgcccgagaacaagcccctggtgtggagtctggcagtttcactcctggccatcattggcctgctcctcggctcctcgcccgacttcaacagccagtttggcctcgtggacatccctgtggagttcaagctggtcattgcccaggtcctgctcctggacttctgcctggcgctcctggccgaccgcgtcctgcagttcttcctggggaccccgaagctgaaagtgccttcctga
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,207 Da
NCBI Official Full Name
Homo sapiens ATPase type 13A1, mRNA
NCBI Official Synonym Full Names
ATPase 13A1
NCBI Official Symbol
ATP13A1
NCBI Official Synonym Symbols
ATP13A; CGI-152
NCBI Protein Information
manganese-transporting ATPase 13A1
UniProt Protein Name
Manganese-transporting ATPase 13A1
UniProt Gene Name
ATP13A1
UniProt Synonym Gene Names
ATP13A; KIAA1825
UniProt Entry Name
AT131_HUMAN

Uniprot Description

ATP13A1: Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type V subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Hydrolase; Membrane protein, multi-pass; Transporter, ion channel; Membrane protein, integral; EC 3.6.3.-

Chromosomal Location of Human Ortholog: 19p13.11

Cellular Component: endoplasmic reticulum membrane; integral to plasma membrane; intracellular membrane-bound organelle; membrane

Molecular Function: cation-transporting ATPase activity; manganese-transporting ATPase activity

Biological Process: cellular calcium ion homeostasis

Research Articles on ATP13A1

Similar Products

Product Notes

The ATP13A1 atp13a1 (Catalog #AAA1275342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgggg atggcaccaa cgacgtgggc gccctgaagc atgctgacgt gggtgtggcg ctcttggcca atgcccctga gcgggttgtc gagcggcgac ggcggccccg ggacagccca accctgagca acagtggcat cagagccacc tccaggacag ccaagcagcg gtcggggctc cctccctccg aggagcagcc aacctcccag agggaccgcc tgagccaggt gctgcgagac ctcgaggacg agagtacgcc cattgtgaaa ctgggggatg ccagcatcgc agcacccttc acctccaagc tctcatccat ccagtgcatc tgccacgtga tcaagcaggg ccgctgcacg ctggtgacca cgctacagat gttcaagatc ctggcgctca atgccctcat cctggcctac agccagagcg tcctctacct ggagggagtc aagttcagtg acttccaggc caccctacag gggctgctgc tggccggctg cttcctcttc atctcccgtt ccaagcccct caagaccctc tcccgagaac ggcccctgcc caacatcttc aacctgtaca ccatcctcac cgtcatgctc cagttctttg tgcacttcct gagccttgtc tacctgtacc gtgaggccca ggcccggagc cccgagaagc aggagcagtt cgtggacttg tacaaggagt ttgagccaag cctggtcaac agcaccgtct acatcatggc catggccatg cagatggcca ccttcgccat caattacaaa ggcccgccct tcatggagag cctgcccgag aacaagcccc tggtgtggag tctggcagtt tcactcctgg ccatcattgg cctgctcctc ggctcctcgc ccgacttcaa cagccagttt ggcctcgtgg acatccctgt ggagttcaag ctggtcattg cccaggtcct gctcctggac ttctgcctgg cgctcctggc cgaccgcgtc ctgcagttct tcctggggac cccgaagctg aaagtgcctt cctga. It is sometimes possible for the material contained within the vial of "ATP13A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.