Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD1A cdna clone

CD1A cDNA Clone

Gene Names
CD1A; R4; T6; CD1; FCB6; HTA1
Synonyms
CD1A; CD1A cDNA Clone; CD1A cdna clone
Ordering
For Research Use Only!
Sequence
atgtggaactggctcaaggagcctctctccttccatgtcatctggatcgcatccttttacaaccattcctggaaacaaaatctggtctcaggttggctgagtgatttgcagactcatacctgggacagcaattccagcaccatcgttttcctgtggccctggtccaggggaaacttcagcaatgaggagtggaaggaactggaaacattattccgtatacgcaccattcggtcatttgagggaattcgtagatacgcccatgaattgcagtttgaatatccttttgagatacaggtgacaggaggctgtgagctgcactctggaaaggtctcaggaagcttcttgcagttagcttatcaaggatcagactttgtgagcttccagaacaattcatggttgccatatccagtggctgggaatatggccaagcatttctgcaaagtgctcaatcagaatcagcatgaaaatgacataacacacaatcttctcagtgacacctgcccacgtttcatcttgggtcttcttgatgcaggaaaggcacatctccagcggcaagtgaagcccgaggcctggctgtcccatggccccagtcctggccctggccatctgcagcttgtgtgccatgtctcaggattctacccaaagcccgtgtgggtgatgtggatgcggggtgagcaggagcagcagggcactcagcgaggggacatcttgcccagtgctgatgggacatggtatctccgcgcaaccctggaggtggccgctggggaggcagctgacctgtcctgtcgggtgaagcacagcagtctagagggccaggacatcgtcctctactgggagcatcacagttccgtgggcttcatcatcttggcggtgatagtgcctttacttcttctgataggtcttgcgctttggttcaggaaacgctgtttctgttaa
Sequence Length
936
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
909
Molecular Weight
37,077 Da
NCBI Official Full Name
Homo sapiens CD1a molecule, mRNA
NCBI Official Synonym Full Names
CD1a molecule
NCBI Official Symbol
CD1A
NCBI Official Synonym Symbols
R4; T6; CD1; FCB6; HTA1
NCBI Protein Information
T-cell surface glycoprotein CD1a
UniProt Protein Name
T-cell surface glycoprotein CD1a
UniProt Gene Name
CD1A
UniProt Synonym Gene Names
hTa1 thymocyte antigen
UniProt Entry Name
CD1A_HUMAN

NCBI Description

This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

CD1A: Antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23.1

Cellular Component: plasma membrane

Molecular Function: beta-2-microglobulin binding; endogenous lipid antigen binding; exogenous lipid antigen binding; protein binding

Biological Process: antigen processing and presentation, exogenous lipid antigen via MHC class Ib; regulation of immune response

Research Articles on CD1A

Similar Products

Product Notes

The CD1A cd1a (Catalog #AAA1275320) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaact ggctcaagga gcctctctcc ttccatgtca tctggatcgc atccttttac aaccattcct ggaaacaaaa tctggtctca ggttggctga gtgatttgca gactcatacc tgggacagca attccagcac catcgttttc ctgtggccct ggtccagggg aaacttcagc aatgaggagt ggaaggaact ggaaacatta ttccgtatac gcaccattcg gtcatttgag ggaattcgta gatacgccca tgaattgcag tttgaatatc cttttgagat acaggtgaca ggaggctgtg agctgcactc tggaaaggtc tcaggaagct tcttgcagtt agcttatcaa ggatcagact ttgtgagctt ccagaacaat tcatggttgc catatccagt ggctgggaat atggccaagc atttctgcaa agtgctcaat cagaatcagc atgaaaatga cataacacac aatcttctca gtgacacctg cccacgtttc atcttgggtc ttcttgatgc aggaaaggca catctccagc ggcaagtgaa gcccgaggcc tggctgtccc atggccccag tcctggccct ggccatctgc agcttgtgtg ccatgtctca ggattctacc caaagcccgt gtgggtgatg tggatgcggg gtgagcagga gcagcagggc actcagcgag gggacatctt gcccagtgct gatgggacat ggtatctccg cgcaaccctg gaggtggccg ctggggaggc agctgacctg tcctgtcggg tgaagcacag cagtctagag ggccaggaca tcgtcctcta ctgggagcat cacagttccg tgggcttcat catcttggcg gtgatagtgc ctttacttct tctgataggt cttgcgcttt ggttcaggaa acgctgtttc tgttaa. It is sometimes possible for the material contained within the vial of "CD1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.