Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAF7 cdna clone

TAF7 cDNA Clone

Gene Names
TAF7; TAF2F; TAFII55
Synonyms
TAF7; TAF7 cDNA Clone; TAF7 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtaaaagcaaagatgatgctcctcacgaactggagagccagtttatcttacgtctgcctccagaatatgcctctactgtgagaagggcagtacagtctggtcatgtcaacctcaaggacagactgacaattgagttacatcctgatgggcgtcatggaatcgtcagagtggaccgtgttccattggcctcaaaattagtagacctgccctgtgttatggaaagcttgaaaaccattgataaaaaaactttttacaagacagctgatatctgtcagatgcttgtatccacagttgatggtgatctctatcctcctgtggaggagccagttgctagcactgatcctaaagcaagcaagaaaaaggataaggacaaagagaaaaagtttatctggaaccacggaattactctgcctctaaagaatgtcaggaagagaaggttccggaagacagcaaagaagaaatatattgaatctccagatgttgaaaaagaagtgaaacgattgctgagtacagatgctgaagctgttagtactcggtgggaaataattgccgaagatgaaacaaaggaggcagaaaatcaaggcctggatatctcttctccaggaatgtctggtcacaggcagggccatgactcattagaacatgatgagcttcgggagatattcaatgacctcagcagcagcagtgaggatgaagatgagacccagcatcaagatgaagaagatataaacatcattgacacggaggaagatctggagagacagctacaggacaagctaaatgaatcagatgaacagcaccaggaaaatgaaggaaccaatcagctggttatgggaattcagaagcagattgacaacatgaaaggcaagctccaagagacccaggacagggcaaaacgacaagaggatctcatcatgaaagtggaaaatctggctctcaagaacagatttcaggctgtactggatgagctcaaacaaaaggaagaccgagaaaaggagcaactcagctctttgcaagaggagctagaatcactcctagagaagtaa
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,259 Da
NCBI Official Full Name
Homo sapiens TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein associated factor 7
NCBI Official Symbol
TAF7
NCBI Official Synonym Symbols
TAF2F; TAFII55
NCBI Protein Information
transcription initiation factor TFIID subunit 7
UniProt Protein Name
Transcription initiation factor TFIID subunit 7
UniProt Gene Name
TAF7
UniProt Synonym Gene Names
TAF2F; TAFII55; TAF(II)55; TAFII-55; TAFII55
UniProt Entry Name
TAF7_HUMAN

NCBI Description

The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]

Uniprot Description

TAF7: Functions as a component of the DNA-binding general transcription factor complex TFIID, a multimeric protein complex that plays a central role in mediating promoter responses to various activators and repressors. Present in both of the previously described TFIID species which either lack or contain TAFII30 (TFIID alpha and TFIID beta respectively). Belongs to the TAF7 family.

Protein type: DNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: Golgi apparatus; nucleoplasm; transcription elongation factor complex b; transcription factor TFIID complex

Molecular Function: histone acetyltransferase binding; protein binding; thyroid hormone receptor binding; transcription coactivator activity; transcription factor activity; transcription factor binding; vitamin D receptor binding

Biological Process: negative regulation of histone acetylation; negative regulation of protein kinase activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; spermine transport; transcription from RNA polymerase II promoter; transcription initiation; transcription initiation from RNA polymerase II promoter; transcriptional preinitiation complex assembly

Research Articles on TAF7

Similar Products

Product Notes

The TAF7 taf7 (Catalog #AAA1275253) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtaaaa gcaaagatga tgctcctcac gaactggaga gccagtttat cttacgtctg cctccagaat atgcctctac tgtgagaagg gcagtacagt ctggtcatgt caacctcaag gacagactga caattgagtt acatcctgat gggcgtcatg gaatcgtcag agtggaccgt gttccattgg cctcaaaatt agtagacctg ccctgtgtta tggaaagctt gaaaaccatt gataaaaaaa ctttttacaa gacagctgat atctgtcaga tgcttgtatc cacagttgat ggtgatctct atcctcctgt ggaggagcca gttgctagca ctgatcctaa agcaagcaag aaaaaggata aggacaaaga gaaaaagttt atctggaacc acggaattac tctgcctcta aagaatgtca ggaagagaag gttccggaag acagcaaaga agaaatatat tgaatctcca gatgttgaaa aagaagtgaa acgattgctg agtacagatg ctgaagctgt tagtactcgg tgggaaataa ttgccgaaga tgaaacaaag gaggcagaaa atcaaggcct ggatatctct tctccaggaa tgtctggtca caggcagggc catgactcat tagaacatga tgagcttcgg gagatattca atgacctcag cagcagcagt gaggatgaag atgagaccca gcatcaagat gaagaagata taaacatcat tgacacggag gaagatctgg agagacagct acaggacaag ctaaatgaat cagatgaaca gcaccaggaa aatgaaggaa ccaatcagct ggttatggga attcagaagc agattgacaa catgaaaggc aagctccaag agacccagga cagggcaaaa cgacaagagg atctcatcat gaaagtggaa aatctggctc tcaagaacag atttcaggct gtactggatg agctcaaaca aaaggaagac cgagaaaagg agcaactcag ctctttgcaa gaggagctag aatcactcct agagaagtaa. It is sometimes possible for the material contained within the vial of "TAF7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.