Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C8A cdna clone

C8A cDNA Clone

Synonyms
C8A; C8A cDNA Clone; C8A cdna clone
Ordering
For Research Use Only!
Sequence
atgtttgctgttgttttcttcatcttgtctttgatgacttgtcagcctggggtaactgcacaggagaaggtgaaccagagagtaagacgggcagctacacccgcagcagttacctgccagctgagcaactggtcagagtggacagattgctttccgtgccaggacaaaaagtaccgacaccggagcctcttgcagccaaacaagtttgggggaaccatctgcagtggtgacatctgggatcaagccagctgctccagttctacaacttgtgtaaggcaagcacagtgtggacaggatttccagtgtaaggagacaggtcgctgcctgaaacgccaccttgtgtgtaatggagaccaggactgccttgatggctctgatgaggacgactgtgaagatgtcagggccattgacgaagactgcagccagtatgaaccaattccaggatcacagaaggcagccttggggtacaatatcctgacccaggaagatgctcagagtgtgtacgatgccagttattatgggggccagtgtgagacggtatacaatggggaatggagggagcttcgatatgactccacctgtgaacgtctctactatggagatgatgagaaatactttcggaaaccctacaactttctgaagtaccactttgaagccctggcagatactggaatctcctcagagttttatgataatgcaaatgaccttctttccaaagttaaaaaagacaagtctgactcatttggagtgaccatcggcataggcccagccggcagccctttattggtgggtgtaggtgtatcccactcacaagacacttcattcttgaacgaattaaacaagtataatgagaagaaattcattttcacaagaatcttcacaaaggtgcagactgcacattttaagatgaggaaggatgacattatgctggatgaaggaatgctgcagtcattaatggagcttccagatcagtacaattatggcatgtatgccaagttcatcaatgactatggcacccattacatcacatctggatccatgggtggcatttatgaatatatcctggtgattgacaaagcaaaaatggaatcccttggtattaccagcagagatatcacgacatgttttggaggctccttgggcattcaatatgaagacaaaataaatgttggtggaggtttatcaggagaccattgtaaaaaatttggaggtggcaaaactgaaagggccaggaaggccatggctgtggaagacattatttctcgggtgcgaggtggcagttctggctggagcggtggcttggcacagaacaggagcaccattacataccgttcctgggggaggtcattaaagtataatcctgttgttatcgattttgagatgcagcctatccacgaggtgctgcggcacacaagcctggggcctctggaggccaagcgccagaacctgcgccgcgccttggaccagtatctgatggaattcaatgcctgccgatgtgggccttgcttcaacaatggggtgcccatcctcgagggcaccagctgcaggtgccagtgccgcctgggtagcttgggtgctgcctgtgagcaaacacagacagaaggagccaaagcagatgggagctggagttgctggagctcctggtctgtatgcagagcaggcatccaggaaaggagaagagagtgtgacaatccagcacctcagaatggaggggcctcgtgtccagggcggaaagtacagacgcaggcttgctga
Sequence Length
1755
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
731
Molecular Weight
65,163 Da
NCBI Official Full Name
Homo sapiens complement component 8, alpha polypeptide, mRNA
UniProt Protein Name
Complement component C8 alpha chain
Protein Family
UniProt Gene Name
C8A
UniProt Entry Name
CO8A_HUMAN

Uniprot Description

C8A: Constituent of the membrane attack complex (MAC) that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. C8A inserts into the target membrane, but does not form pores by itself. Defects in C8A are a cause of complement component 8 deficiency type 1 (C8D1). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis. Belongs to the complement C6/C7/C8/C9 family.

Protein type: Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 1p32

Cellular Component: extracellular region; extracellular space; membrane; membrane attack complex

Biological Process: complement activation; immune response; regulation of complement activation

Disease: Complement Component 8 Deficiency, Type I

Similar Products

Product Notes

The C8A c8a (Catalog #AAA1275248) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttgctg ttgttttctt catcttgtct ttgatgactt gtcagcctgg ggtaactgca caggagaagg tgaaccagag agtaagacgg gcagctacac ccgcagcagt tacctgccag ctgagcaact ggtcagagtg gacagattgc tttccgtgcc aggacaaaaa gtaccgacac cggagcctct tgcagccaaa caagtttggg ggaaccatct gcagtggtga catctgggat caagccagct gctccagttc tacaacttgt gtaaggcaag cacagtgtgg acaggatttc cagtgtaagg agacaggtcg ctgcctgaaa cgccaccttg tgtgtaatgg agaccaggac tgccttgatg gctctgatga ggacgactgt gaagatgtca gggccattga cgaagactgc agccagtatg aaccaattcc aggatcacag aaggcagcct tggggtacaa tatcctgacc caggaagatg ctcagagtgt gtacgatgcc agttattatg ggggccagtg tgagacggta tacaatgggg aatggaggga gcttcgatat gactccacct gtgaacgtct ctactatgga gatgatgaga aatactttcg gaaaccctac aactttctga agtaccactt tgaagccctg gcagatactg gaatctcctc agagttttat gataatgcaa atgaccttct ttccaaagtt aaaaaagaca agtctgactc atttggagtg accatcggca taggcccagc cggcagccct ttattggtgg gtgtaggtgt atcccactca caagacactt cattcttgaa cgaattaaac aagtataatg agaagaaatt cattttcaca agaatcttca caaaggtgca gactgcacat tttaagatga ggaaggatga cattatgctg gatgaaggaa tgctgcagtc attaatggag cttccagatc agtacaatta tggcatgtat gccaagttca tcaatgacta tggcacccat tacatcacat ctggatccat gggtggcatt tatgaatata tcctggtgat tgacaaagca aaaatggaat cccttggtat taccagcaga gatatcacga catgttttgg aggctccttg ggcattcaat atgaagacaa aataaatgtt ggtggaggtt tatcaggaga ccattgtaaa aaatttggag gtggcaaaac tgaaagggcc aggaaggcca tggctgtgga agacattatt tctcgggtgc gaggtggcag ttctggctgg agcggtggct tggcacagaa caggagcacc attacatacc gttcctgggg gaggtcatta aagtataatc ctgttgttat cgattttgag atgcagccta tccacgaggt gctgcggcac acaagcctgg ggcctctgga ggccaagcgc cagaacctgc gccgcgcctt ggaccagtat ctgatggaat tcaatgcctg ccgatgtggg ccttgcttca acaatggggt gcccatcctc gagggcacca gctgcaggtg ccagtgccgc ctgggtagct tgggtgctgc ctgtgagcaa acacagacag aaggagccaa agcagatggg agctggagtt gctggagctc ctggtctgta tgcagagcag gcatccagga aaggagaaga gagtgtgaca atccagcacc tcagaatgga ggggcctcgt gtccagggcg gaaagtacag acgcaggctt gctga. It is sometimes possible for the material contained within the vial of "C8A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.