Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P4HA2 cdna clone

P4HA2 cDNA Clone

Synonyms
P4HA2; P4HA2 cDNA Clone; P4HA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaactctgggtgtctgcattgctgatggcctggtttggtgtcctgagctgtgtgcaggccgaattcttcacctctattgggcacatgactgacctgatttatgcagagaaagagctggtgcagtctctgaaagagtacatccttgtggaggaagccaagctttccaagattaagagctgggccaacaaaatggaagccttgactagcaagtcagctgctgatgctgagggctacctggctcaccctgtgaatgcctacaaactggtgaagcggctaaacacagactggcctgcgctggaggaccttgtcctgcaggactcagctgcaggttttatcgccaacctctctgtgcagcggcagttcttccccactgatgaggacgagataggagctgccaaagccctgatgagacttcaggacacatacaggctggacccaggcacaatttccagaggggaacttccaggaaccaagtaccaggcaatgctgagtgtggatgactgctttgggatgggccgctcggcctacaatgaaggggactattatcatacggtgttgtggatggagcaggtgctaaagcagcttgatgccggggaggaggccaccacaaccaagtcacaggtgctggactacctcagctatgctgtcttccagttgggtgatctgcaccgtgccctggagctcacccgccgcctgctctcccttgacccaagccacgaacgagctggagggaatctgcggtactttgagcagttattggaggaagagagagaaaaaacgttaacaaatcagacagaagctgagctagcaaccccagaaggcatctatgagaggcctgtggactacctgcctgagagggatgtttacgagagcctctgtcgtggggagggtgtcaaactgacaccccgtagacagaagaggcttttctgtaggtaccaccatggcaacagggccccacagctgctcattgcccccttcaaagaggaggacgagtgggacagcccgcacatcgtcaggtactacgatgtcatgtctgatgaggaaatcgagaggatcaaggagatcgcaaaacctaaacttgcacgagccaccgttcgtgatcccaagacaggagtcctcactgtcgccagctaccgggtttccaaaagctcctggctagaggaagatgatgaccctgttgtggcccgagtaaatcgtcggatgcagcatatcacagggttaacagtaaagactgcagaattgttacaggttgcaaattatggagtgggaggacagtatgaaccgcacttcgacttctctaggcgaccttttgacagcggcctcaaaacagaggggaataggttagcgacgtttcttaactacatgagtgatgtagaagctggtggtgccaccgtcttccctgatctgggggctgcaatttggcctaagaagggtacagctgtgttctggtacaacctcttgcggagcggggaaggtgactaccgaacaagacatgctgcctgccctgtgcttgtgggctgcaagtgggtctccaataagtggttccatgaacgaggacaggagttcttgagaccttgtggatcaacagaagttgactga
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,633 Da
NCBI Official Full Name
Homo sapiens prolyl 4-hydroxylase, alpha polypeptide II, mRNA
NCBI Official Synonym Full Names
prolyl 4-hydroxylase subunit alpha 2
NCBI Official Symbol
P4HA2
NCBI Protein Information
prolyl 4-hydroxylase subunit alpha-2
UniProt Protein Name
Prolyl 4-hydroxylase subunit alpha-2
Protein Family
UniProt Gene Name
P4HA2
UniProt Synonym Gene Names
4-PH alpha-2
UniProt Entry Name
P4HA2_HUMAN

NCBI Description

This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

P4HA2: Catalyzes the post-translational formation of 4- hydroxyproline in -Xaa-Pro-Gly- sequences in collagens and other proteins. Belongs to the P4HA family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Oxidoreductase; Secreted, signal peptide; EC 1.14.11.2; Amino Acid Metabolism - arginine and proline

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum lumen; intracellular membrane-bound organelle; nucleus

Molecular Function: electron carrier activity

Research Articles on P4HA2

Similar Products

Product Notes

The P4HA2 p4ha2 (Catalog #AAA1275187) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaactct gggtgtctgc attgctgatg gcctggtttg gtgtcctgag ctgtgtgcag gccgaattct tcacctctat tgggcacatg actgacctga tttatgcaga gaaagagctg gtgcagtctc tgaaagagta catccttgtg gaggaagcca agctttccaa gattaagagc tgggccaaca aaatggaagc cttgactagc aagtcagctg ctgatgctga gggctacctg gctcaccctg tgaatgccta caaactggtg aagcggctaa acacagactg gcctgcgctg gaggaccttg tcctgcagga ctcagctgca ggttttatcg ccaacctctc tgtgcagcgg cagttcttcc ccactgatga ggacgagata ggagctgcca aagccctgat gagacttcag gacacataca ggctggaccc aggcacaatt tccagagggg aacttccagg aaccaagtac caggcaatgc tgagtgtgga tgactgcttt gggatgggcc gctcggccta caatgaaggg gactattatc atacggtgtt gtggatggag caggtgctaa agcagcttga tgccggggag gaggccacca caaccaagtc acaggtgctg gactacctca gctatgctgt cttccagttg ggtgatctgc accgtgccct ggagctcacc cgccgcctgc tctcccttga cccaagccac gaacgagctg gagggaatct gcggtacttt gagcagttat tggaggaaga gagagaaaaa acgttaacaa atcagacaga agctgagcta gcaaccccag aaggcatcta tgagaggcct gtggactacc tgcctgagag ggatgtttac gagagcctct gtcgtgggga gggtgtcaaa ctgacacccc gtagacagaa gaggcttttc tgtaggtacc accatggcaa cagggcccca cagctgctca ttgccccctt caaagaggag gacgagtggg acagcccgca catcgtcagg tactacgatg tcatgtctga tgaggaaatc gagaggatca aggagatcgc aaaacctaaa cttgcacgag ccaccgttcg tgatcccaag acaggagtcc tcactgtcgc cagctaccgg gtttccaaaa gctcctggct agaggaagat gatgaccctg ttgtggcccg agtaaatcgt cggatgcagc atatcacagg gttaacagta aagactgcag aattgttaca ggttgcaaat tatggagtgg gaggacagta tgaaccgcac ttcgacttct ctaggcgacc ttttgacagc ggcctcaaaa cagaggggaa taggttagcg acgtttctta actacatgag tgatgtagaa gctggtggtg ccaccgtctt ccctgatctg ggggctgcaa tttggcctaa gaagggtaca gctgtgttct ggtacaacct cttgcggagc ggggaaggtg actaccgaac aagacatgct gcctgccctg tgcttgtggg ctgcaagtgg gtctccaata agtggttcca tgaacgagga caggagttct tgagaccttg tggatcaaca gaagttgact ga. It is sometimes possible for the material contained within the vial of "P4HA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.