ZMIZ2 cdna clone
ZMIZ2 cDNA Clone
Gene Names
ZMIZ2; NET27; ZIMP7; hZIMP7; TRAFIP20
Synonyms
ZMIZ2; ZMIZ2 cDNA Clone; ZMIZ2 cdna clone
Sequence
atgaacaccaactggccagcctcggtgcaggtcagcgtcaatgccacgccgctcaccatcgagcgtggcgacaacaagacctcgcacaagccactctacctgaagcatgtgtgccagccaggccgcaacaccatccagatcaccgtcaccgcctgctgctgctcccacctcttcgtgctgcagctagtgcaccgcccatccgtccgctcggtgctgcagggcctcctcaaaaagcgcctcctgcctgctgagcactgcatcaccaagataaagcggaacttcagcagcggcaccatccctggcacccctgggcccaacggagaggacggggtggagcagacagctatcaaggtgtccctgaagtgccccatcaccttccgcaggatccagctccctgcccgaggtcatgactgtcgccacatacagtgctttgacctggagtcgtacctgcagctcaactgtgagcgggggacttggaggtgtcctgtgtgcaacaagacagctttgctggagggcctggaggtggaccagtacatgctgggcatcctgatttacattcagaactctgactatgaggagatcaccatcgaccccacgtgcagctggaagccagtgcccgtgaagcctgacatgcacatcaaggaggagccggatgggccagcactgaagcgctgccgcaccgtgagccccgcccacgtgctcatgcccagcgtgatggagatgatcgccgccctgggccccggcgctgccccctttgcccccctgcagcccccctcagtccctgcccccagcgactaccctggccagggttccagcttcctggggcctggaactttccctgagtccttcccacccaccacgcccagcaccccaacccttgctgagttcaccccgggaccaccccccatctcctaccagtctgacattcccagcagcctcctgacttcagagaagtctaccgcctgcctcccaagccagatggcaccagcaggtcacctggaccccactcacaatcctgggacaccaggactacacacctccaaccttggggcccctccaggtccccagctgcaccattcaaaccctcccccagcgtcccggcagtccttgggccaagcgagcttaggacctacgggtgaactggccttcagtcctgccacaggcgtgatggggccccccagcatgtctggagccggggaggccccagaaccagctctggacctgctcccggaactgaccaaccctgatgagctactgtcctacttgggcccacccgacctccctacgaacaacaatgacgacctgctttctctgtttgagaacaactga
Sequence Length
1329
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
91,112 Da
NCBI Official Full Name
Homo sapiens zinc finger, MIZ-type containing 2, mRNA
NCBI Official Synonym Full Names
zinc finger MIZ-type containing 2
NCBI Official Symbol
ZMIZ2
NCBI Official Synonym Symbols
NET27; ZIMP7; hZIMP7; TRAFIP20
NCBI Protein Information
zinc finger MIZ domain-containing protein 2
UniProt Protein Name
Zinc finger MIZ domain-containing protein 2
Protein Family
UniProt Gene Name
ZMIZ2
UniProt Synonym Gene Names
KIAA1886; ZIMP7
UniProt Entry Name
ZMIZ2_HUMAN
NCBI Description
ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]).[supplied by OMIM, May 2010]
Uniprot Description
ZIMP7: Increases ligand-dependent transcriptional activity of AR and other nuclear hormone receptors. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor
Chromosomal Location of Human Ortholog: 7p13
Cellular Component: mitochondrion; nuclear replication fork; nucleoplasm; nucleus
Molecular Function: ligand-dependent nuclear receptor transcription coactivator activity; protein binding
Biological Process: positive regulation of transcription from RNA polymerase II promoter
Research Articles on ZMIZ2
Similar Products
Product Notes
The ZMIZ2 zmiz2 (Catalog #AAA1275093) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacacca actggccagc ctcggtgcag gtcagcgtca atgccacgcc gctcaccatc gagcgtggcg acaacaagac ctcgcacaag ccactctacc tgaagcatgt gtgccagcca ggccgcaaca ccatccagat caccgtcacc gcctgctgct gctcccacct cttcgtgctg cagctagtgc accgcccatc cgtccgctcg gtgctgcagg gcctcctcaa aaagcgcctc ctgcctgctg agcactgcat caccaagata aagcggaact tcagcagcgg caccatccct ggcacccctg ggcccaacgg agaggacggg gtggagcaga cagctatcaa ggtgtccctg aagtgcccca tcaccttccg caggatccag ctccctgccc gaggtcatga ctgtcgccac atacagtgct ttgacctgga gtcgtacctg cagctcaact gtgagcgggg gacttggagg tgtcctgtgt gcaacaagac agctttgctg gagggcctgg aggtggacca gtacatgctg ggcatcctga tttacattca gaactctgac tatgaggaga tcaccatcga ccccacgtgc agctggaagc cagtgcccgt gaagcctgac atgcacatca aggaggagcc ggatgggcca gcactgaagc gctgccgcac cgtgagcccc gcccacgtgc tcatgcccag cgtgatggag atgatcgccg ccctgggccc cggcgctgcc ccctttgccc ccctgcagcc cccctcagtc cctgccccca gcgactaccc tggccagggt tccagcttcc tggggcctgg aactttccct gagtccttcc cacccaccac gcccagcacc ccaacccttg ctgagttcac cccgggacca ccccccatct cctaccagtc tgacattccc agcagcctcc tgacttcaga gaagtctacc gcctgcctcc caagccagat ggcaccagca ggtcacctgg accccactca caatcctggg acaccaggac tacacacctc caaccttggg gcccctccag gtccccagct gcaccattca aaccctcccc cagcgtcccg gcagtccttg ggccaagcga gcttaggacc tacgggtgaa ctggccttca gtcctgccac aggcgtgatg gggcccccca gcatgtctgg agccggggag gccccagaac cagctctgga cctgctcccg gaactgacca accctgatga gctactgtcc tacttgggcc cacccgacct ccctacgaac aacaatgacg acctgctttc tctgtttgag aacaactga. It is sometimes possible for the material contained within the vial of "ZMIZ2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
