Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC25A10 cdna clone

SLC25A10 cDNA Clone

Gene Names
SLC25A10; DIC
Synonyms
SLC25A10; SLC25A10 cDNA Clone; SLC25A10 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagccgaggcgcgcgtgtcgcgctggtacttcggggggctggcctcctgcggggccgcctgctgcacgcacccgctggacctgctcaaggtgcatctgcagacgcagcaggaggtgaagctgcgcatgacgggcatggcgctgcgggtggtgcgtaccgacggcatcctggcactctacagcggcctgagcgcctcgctgtgcagacagatgacctactccctgactcggttcgccatctacgagactgtgcgggaccgcgtggccaagggcagccaggggcctctccccttccacgagaaggtgttgctgggctccgtcagcggtttagctggaggcttcgtggggacgcccgcagacttggtcaacgtcaggatgcagaacgacgtgaagctgccccagggtcagcggcgcaactacgcccatgcgctggatggcctgtaccgcgtagctcgtgaagagggtctcaggagactgttctcgggtgcaaccatggcatccagccgaggggccttagtcactgtgggccagctgtcctgctacgaccaggccaagcagctggtccttagcaccgggtacctctctgacaacatcttcactcactttgtcgccagctttattgcagccgctggtgacgagccccctcctcagggtggatgtgccacgttcctgtgccagcccctggatgtgctgaagactcgcctgatgaactccaagggggagtatcagggcgttttccactgcgccgtggagacagcgaagctcgggcctctggccttttacaagggcctcgtcccagctggcatccgcctcatcccccacaccgtgctcacttttgtgtttctggaacagctacgcaaaaactttggcatcaaagtgccatcctga
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,145 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 10
NCBI Official Symbol
SLC25A10
NCBI Official Synonym Symbols
DIC
NCBI Protein Information
mitochondrial dicarboxylate carrier
UniProt Protein Name
Mitochondrial dicarboxylate carrier
UniProt Gene Name
SLC25A10
UniProt Synonym Gene Names
DIC
UniProt Entry Name
DIC_HUMAN

NCBI Description

This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]

Uniprot Description

SLC25A10: Involved in translocation of malonate, malate and succinate in exchange for phosphate, sulfate, sulfite or thiosulfate across mitochondrial inner membrane. Belongs to the mitochondrial carrier family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Mitochondrial; Transporter, SLC family; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: mitochondrial inner membrane; nucleus

Molecular Function: dicarboxylic acid transmembrane transporter activity; protein binding; structural constituent of ribosome

Biological Process: dicarboxylic acid transport; gluconeogenesis; ion transport; translation

Research Articles on SLC25A10

Similar Products

Product Notes

The SLC25A10 slc25a10 (Catalog #AAA1275077) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccg aggcgcgcgt gtcgcgctgg tacttcgggg ggctggcctc ctgcggggcc gcctgctgca cgcacccgct ggacctgctc aaggtgcatc tgcagacgca gcaggaggtg aagctgcgca tgacgggcat ggcgctgcgg gtggtgcgta ccgacggcat cctggcactc tacagcggcc tgagcgcctc gctgtgcaga cagatgacct actccctgac tcggttcgcc atctacgaga ctgtgcggga ccgcgtggcc aagggcagcc aggggcctct ccccttccac gagaaggtgt tgctgggctc cgtcagcggt ttagctggag gcttcgtggg gacgcccgca gacttggtca acgtcaggat gcagaacgac gtgaagctgc cccagggtca gcggcgcaac tacgcccatg cgctggatgg cctgtaccgc gtagctcgtg aagagggtct caggagactg ttctcgggtg caaccatggc atccagccga ggggccttag tcactgtggg ccagctgtcc tgctacgacc aggccaagca gctggtcctt agcaccgggt acctctctga caacatcttc actcactttg tcgccagctt tattgcagcc gctggtgacg agccccctcc tcagggtgga tgtgccacgt tcctgtgcca gcccctggat gtgctgaaga ctcgcctgat gaactccaag ggggagtatc agggcgtttt ccactgcgcc gtggagacag cgaagctcgg gcctctggcc ttttacaagg gcctcgtccc agctggcatc cgcctcatcc cccacaccgt gctcactttt gtgtttctgg aacagctacg caaaaacttt ggcatcaaag tgccatcctg a. It is sometimes possible for the material contained within the vial of "SLC25A10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.