Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TPM3 cdna clone

TPM3 cDNA Clone

Gene Names
TPM3; TM3; TM5; TRK; CFTD; NEM1; TM-5; TM30; CAPM1; TM30nm; TPMsk3; hscp30; HEL-189; HEL-S-82p; OK/SW-cl.5
Synonyms
TPM3; TPM3 cDNA Clone; TPM3 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggaggccatcaagaaaaagatgcagatgctgaagttagacaaggagaatgctctggatcgggcagagcaagctgaagctgagcagaagcaggcagaagaaagaagtaaacagctggaggatgagctggcagccatgcagaagaagctgaaagggacagaggatgagctggacaagtattctgaagctttgaaggatgcccaggagaagctggaactggcagagaagaaggctgctgatgctgaggctgaggtggcctccttgaaccgtaggatccagctggttgaagaagagctggaccgtgctcaggagcgcctggccactgccctgcaaaagctggaagaagctgaaaaagctgctgatgagagtgagagaggtatgaaggttattgaaaaccgggccttaaaagatgaagaaaagatggaactccaggaaatccaactcaaagaagctaagcacattgcagaagaggcagataggaagtatgaagaggtggctcgtaagttggtgatcattgaaggagacttggaacgcacagaggaacgagctgagctggcagagtctaagtgttctgagctggaggaggagctgaagaatgtcaccaacaacctcaagtctcttgaggctcaggcggagaagtactctcaaaaagaagataaatatgaggaagaaatcaagattcttactgataaactcaaggaggcagagacccgtgctgagtttgctgagagatcggtagccaagctggaaaagacaattgatgacctggaagatgagctctatgcccagaaactgaagtacaaggccattagcgaggagctggaccacgccctcaatgacatgacctctatataa
Sequence Length
858
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,603 Da
NCBI Official Full Name
Homo sapiens tropomyosin 3, mRNA
NCBI Official Synonym Full Names
tropomyosin 3
NCBI Official Symbol
TPM3
NCBI Official Synonym Symbols
TM3; TM5; TRK; CFTD; NEM1; TM-5; TM30; CAPM1; TM30nm; TPMsk3; hscp30; HEL-189; HEL-S-82p; OK/SW-cl.5
NCBI Protein Information
tropomyosin alpha-3 chain
UniProt Protein Name
Tropomyosin alpha-3 chain
Protein Family
UniProt Gene Name
TPM3
UniProt Synonym Gene Names
hTM5
UniProt Entry Name
TPM3_HUMAN

NCBI Description

This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Uniprot Description

TPM3: a cytoskeletal protein that binds to actin filaments in muscle and nonmuscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments. Defects in TPM3 are a cause of nemaline myopathy type 1 (NEM1). Three alternatively spliced isoforms have been described.

Protein type: Actin-binding; Contractile; Cytoskeletal; Motility/polarity/chemotaxis; Motor; Oncoprotein

Chromosomal Location of Human Ortholog: 1q21.2

Cellular Component: actin filament; cytoskeleton; cytosol; muscle thin filament tropomyosin; stress fiber

Molecular Function: actin filament binding; protein binding; structural constituent of muscle

Biological Process: actin filament organization; cell motility; muscle contraction; muscle filament sliding

Disease: Myopathy, Congenital, With Fiber-type Disproportion; Nemaline Myopathy 1

Research Articles on TPM3

Similar Products

Product Notes

The TPM3 tpm3 (Catalog #AAA1274935) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggagg ccatcaagaa aaagatgcag atgctgaagt tagacaagga gaatgctctg gatcgggcag agcaagctga agctgagcag aagcaggcag aagaaagaag taaacagctg gaggatgagc tggcagccat gcagaagaag ctgaaaggga cagaggatga gctggacaag tattctgaag ctttgaagga tgcccaggag aagctggaac tggcagagaa gaaggctgct gatgctgagg ctgaggtggc ctccttgaac cgtaggatcc agctggttga agaagagctg gaccgtgctc aggagcgcct ggccactgcc ctgcaaaagc tggaagaagc tgaaaaagct gctgatgaga gtgagagagg tatgaaggtt attgaaaacc gggccttaaa agatgaagaa aagatggaac tccaggaaat ccaactcaaa gaagctaagc acattgcaga agaggcagat aggaagtatg aagaggtggc tcgtaagttg gtgatcattg aaggagactt ggaacgcaca gaggaacgag ctgagctggc agagtctaag tgttctgagc tggaggagga gctgaagaat gtcaccaaca acctcaagtc tcttgaggct caggcggaga agtactctca aaaagaagat aaatatgagg aagaaatcaa gattcttact gataaactca aggaggcaga gacccgtgct gagtttgctg agagatcggt agccaagctg gaaaagacaa ttgatgacct ggaagatgag ctctatgccc agaaactgaa gtacaaggcc attagcgagg agctggacca cgccctcaat gacatgacct ctatataa. It is sometimes possible for the material contained within the vial of "TPM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.