Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LAPTM4A cdna clone

LAPTM4A cDNA Clone

Gene Names
LAPTM4A; MBNT; Mtrp; LAPTM4; HUMORF13
Synonyms
LAPTM4A; LAPTM4A cDNA Clone; LAPTM4A cdna clone
Ordering
For Research Use Only!
Sequence
atggtgtccatgagtttcaagcggaaccgcagtgaccggttctacagcacccggtgctgcggctgttgccatgtccgcaccgggacgatcatcctggggacctggtacatggtagtaaacctattgatggcaattttgctgactgtggaagtgactcatccaaactccatgccagctgtcaacattcagtatgaagtcatcggtaattactattcgtctgagagaatggctgataatgcctgtgttctttttgccgtctctgttcttatgtttataatcagttcaatgctggtttatggagcaatttcttatcaagtgggttggctgattccattcttctgttaccgactttttgacttcgtcctcagttgcctggttgctattagttctctcacctatttgccaagaatcaaagaatatctggatcaactacctgattttccctacaaagatgacctcctggccttggactccagctgcctcctgttcattgttcttgtgttctttgccttattcatcatttttaaggcttatctaattaactgtgtttggaactgctataaatacatcaacaaccgaaacgtgccggagattgctgtgtaccctgcctttgaagcacctcctcagtacgttttgccaacctatgaaatggccgtgaaaatgcctgaaaaagaaccaccacctccttacttacctgcctga
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,801 Da
NCBI Official Full Name
Homo sapiens lysosomal protein transmembrane 4 alpha, mRNA
NCBI Official Synonym Full Names
lysosomal protein transmembrane 4 alpha
NCBI Official Symbol
LAPTM4A
NCBI Official Synonym Symbols
MBNT; Mtrp; LAPTM4; HUMORF13
NCBI Protein Information
lysosomal-associated transmembrane protein 4A
UniProt Protein Name
Lysosomal-associated transmembrane protein 4A
UniProt Gene Name
LAPTM4A
UniProt Synonym Gene Names
KIAA0108; LAPTM4; MBNT; MTRP
UniProt Entry Name
LAP4A_HUMAN

NCBI Description

This gene encodes a protein that has four predicted transmembrane domains. The function of this gene has not yet been determined; however, studies in the mouse homolog suggest a role in the transport of small molecules across endosomal and lysosomal membranes. [provided by RefSeq, Jul 2008]

Uniprot Description

LAPTM4A: May function in the transport of nucleosides and/or nucleoside derivatives between the cytosol and the lumen of an intracellular membrane-bound compartment. Belongs to the LAPTM4/LAPTM5 transporter family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Vesicle

Chromosomal Location of Human Ortholog: 2p24.1

Cellular Component: Golgi apparatus; membrane

Research Articles on LAPTM4A

Similar Products

Product Notes

The LAPTM4A laptm4a (Catalog #AAA1274845) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtcca tgagtttcaa gcggaaccgc agtgaccggt tctacagcac ccggtgctgc ggctgttgcc atgtccgcac cgggacgatc atcctgggga cctggtacat ggtagtaaac ctattgatgg caattttgct gactgtggaa gtgactcatc caaactccat gccagctgtc aacattcagt atgaagtcat cggtaattac tattcgtctg agagaatggc tgataatgcc tgtgttcttt ttgccgtctc tgttcttatg tttataatca gttcaatgct ggtttatgga gcaatttctt atcaagtggg ttggctgatt ccattcttct gttaccgact ttttgacttc gtcctcagtt gcctggttgc tattagttct ctcacctatt tgccaagaat caaagaatat ctggatcaac tacctgattt tccctacaaa gatgacctcc tggccttgga ctccagctgc ctcctgttca ttgttcttgt gttctttgcc ttattcatca tttttaaggc ttatctaatt aactgtgttt ggaactgcta taaatacatc aacaaccgaa acgtgccgga gattgctgtg taccctgcct ttgaagcacc tcctcagtac gttttgccaa cctatgaaat ggccgtgaaa atgcctgaaa aagaaccacc acctccttac ttacctgcct ga. It is sometimes possible for the material contained within the vial of "LAPTM4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.