Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGBL4 cdna clone

AGBL4 cDNA Clone

Gene Names
AGBL4; CCP6
Synonyms
AGBL4; AGBL4 cDNA Clone; AGBL4 cdna clone
Ordering
For Research Use Only!
Sequence
atggattacttctttcgggagcagctgggccagagtgtgcaacaacgaaagcttgacctcctgacgataaccagccctgacaatctccgggaaggggcagagcagaaggtggtattcatcacaggacgagtccacccaggggaaacaccctcatcatttgtgtgccaagggatcattgacttccttgtaagccagcaccctattgcctgtgtcctccgggaatacctggtcttcaagatcgcaccaatgctcaatcctgatggagtctacctgggcaattacaggtgttctctgatgggatttgatctgaatcgtcactggctggatccctctccatgggtccatcctaccctgcatggagtgaaacaactcatcgtccagatgtacaacgacccaaaaacaagcctggagttttatattgacatccatgcccactccaccatgatgaatggcttcatgtatggcaacatctttgaggatgaggaacggttccagaggcaggccatttttcccaagctcctctgccagaatgctgaggacttctcctattccagcacatcctttaaccgggacgctgtgaaagcaggaactggccgtcgcttcctcggtggactcctggaccacacttcctattgctacaccctagaggtctccttctacagctacatcatcagtggcaccacggctgctgtgccctacactgaagaagcctgtatccttagtccccacccagccttgggccagccctcatccagccgagagtatccaagtctgacaggtcaggaattaggcccccagctcaggtaa
Sequence Length
807
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,505 Da
NCBI Official Full Name
Homo sapiens ATP/GTP binding protein-like 4, mRNA
NCBI Official Synonym Full Names
ATP/GTP binding protein like 4
NCBI Official Symbol
AGBL4
NCBI Official Synonym Symbols
CCP6
NCBI Protein Information
cytosolic carboxypeptidase 6
UniProt Protein Name
Cytosolic carboxypeptidase 6
UniProt Gene Name
AGBL4
UniProt Synonym Gene Names
CCP6
UniProt Entry Name
CBPC6_HUMAN

Uniprot Description

AGBL4: Metallocarboxypeptidase that mediates deglutamylation of target proteins. Catalyzes the deglutamylation of polyglutamate side chains generated by post-translational polyglutamylation in proteins such as tubulins. Also removes gene-encoded polyglutamates from the carboxy-terminus of target proteins such as MYLK. Acts as a long-chain deglutamylase and specifically shortens long polyglutamate chains, while it is not able to remove the branching point glutamate, a process catalyzed by AGBL5/CCP5. Belongs to the peptidase M14 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; EC 3.4.17.-

Chromosomal Location of Human Ortholog: 1p33

Cellular Component: centriole; cytosol; Golgi apparatus

Molecular Function: metallocarboxypeptidase activity; tubulin binding

Biological Process: defense response to virus

Research Articles on AGBL4

Similar Products

Product Notes

The AGBL4 agbl4 (Catalog #AAA1274790) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattact tctttcggga gcagctgggc cagagtgtgc aacaacgaaa gcttgacctc ctgacgataa ccagccctga caatctccgg gaaggggcag agcagaaggt ggtattcatc acaggacgag tccacccagg ggaaacaccc tcatcatttg tgtgccaagg gatcattgac ttccttgtaa gccagcaccc tattgcctgt gtcctccggg aatacctggt cttcaagatc gcaccaatgc tcaatcctga tggagtctac ctgggcaatt acaggtgttc tctgatggga tttgatctga atcgtcactg gctggatccc tctccatggg tccatcctac cctgcatgga gtgaaacaac tcatcgtcca gatgtacaac gacccaaaaa caagcctgga gttttatatt gacatccatg cccactccac catgatgaat ggcttcatgt atggcaacat ctttgaggat gaggaacggt tccagaggca ggccattttt cccaagctcc tctgccagaa tgctgaggac ttctcctatt ccagcacatc ctttaaccgg gacgctgtga aagcaggaac tggccgtcgc ttcctcggtg gactcctgga ccacacttcc tattgctaca ccctagaggt ctccttctac agctacatca tcagtggcac cacggctgct gtgccctaca ctgaagaagc ctgtatcctt agtccccacc cagccttggg ccagccctca tccagccgag agtatccaag tctgacaggt caggaattag gcccccagct caggtaa. It is sometimes possible for the material contained within the vial of "AGBL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.