Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC24C cdna clone

SEC24C cDNA Clone

Synonyms
SEC24C; SEC24C cDNA Clone; SEC24C cdna clone
Ordering
For Research Use Only!
Sequence
atgaacgtcaaccagtcagttccacctgtgccaccatttgggcagccccagcccatctacccagggtatcatcagtccagctatggtgggcaatcagggtccacagcccccgccattccctatggagcctacaatggcccagtaccaggctatcagcaaacacctccccaaggtatgtcaagagccccaccttcctcgggggcacctccagcctcaacagcacaggctccttgtggccaggctgcatatggccagtttggccaaggagatgtacagaatgggccaagctccactgttcagatgcaaaggctgcctgggtctcagtcatttgggtccccattggcccctgtgggcaaccagccacctgtgcttcagccctatggccctcccccgacaagtgcacaggtggctacgcagctgtctggaatgcagatcagcggtgctgtggccccagcccctccttcttcagggctgggctttggcccaccaacatcgctggcttcagcctcaggaagtttccctaactctggtctgtatggctcctatcctcagggccaggctcctccccttagccaggcccaaggtcatcctgggatccagactccccagcgatctgccccatcacaggcctccagcttcacacccccagcttcagggggtcctcggctgccttcgatgactggtccactcctgcctggacagagttttggagggccctcagtgagccagcccaaccatgtgtcttcacctcctcaagctctgccccctggcacccagatgactgggcccctgggaccactgccacctatgcactccccgcagcagccaggctatcagccccaacaaaatggttccttcggaccagcccggggccctcagtctaattatggaggcccctacccagcagcacccacctttggcagtcagcctgggcctcctcagccactgcctcctaagcgcctggaccctgatgccatcccaagccctattcaggtcattgaagatgacaggaacaaccggggtacagagccatttgttactggagtacggggccaggtgccacccttagtcactaccaacttcctggtgaaagaccaagggaatgcaagtccccgatacatccgatgtacatcctataatatcccttgcacatctgacatggctaagcaggctcaggtgcccctggcagcagtcatcaaaccgctggcaaggctgcccccagaggaggcttcaccgtatgttgtggaccatggggaatctggccctttgcgctgcaaccgctgcaaagcatacatgtgtcccttcatgcagttcattgaaggagggaggcgtttccagtgctgtttttgcagctgtatcaatgatgttcccccccagtattttcagcacctggatcataccggcaaacgtgtggatgcttatgaccgccctgagctatccctgggctcttatgaattcttggccactgtagattactgcaagaacaataagttccccagccctcctgcctttatcttcatgattgacgtctcctacaatgccatcaggactggtcttgttaggctcctctgtgaggagctcaagtcactgttagactttctacctagggagggtggggcagaagagtcagcaatccgcgttggctttgtcacctacaataaggtgctccacttctataatgtgaagagctcattggcccagccacagatgatggttgtgtctgatgtggctgacatgtttgtgccactgctggatggcttcctggtcaacgtcaatgagtctcgggcagttatcaccagcttattggatcagattccagaaatgtttgcagacacaagggaaacagagacagtatttgtaccagttatccaggctggaatggaggctctgaaggctgctgagtgtgcagggaagctctttctattccatacatccctgcccattgcagaggccccagggaaactgaagaacagagatgacaggaagctgatcaatacagacaaggagaagactctgttccagcctcagacaggtgcctatcagaccctggccaaagagtgtgtggcccaaggctgctgtgtagatctctttctcttccctaaccagtatgtggatgtggccacactctctgttgtgccccagctcactggtggctctgtctacaaatatgcttcctttcaggtggagaacgaccaggagcggttcctgagtgacctgcgtcgtgatgtccagaaggttgttggctttgatgctgtgatgcgggtccggacaagcactggtatccgtgctgtagatttctttggagctttctacatgagcaacacgacagatgtggagctggctgggctagatggggacaaaacagtgactgtggagttcaagcatgacgatcggctcaatgaagagagcggagctctcctgcagtgtgccctgctttacaccagctgtgcagggcagcgtcggctccgcatccataatctggccctgaactgctgcacccagctggctgatctatatcgaaactgtgagactgacacgctcatcaactacatggccaagtttgcatatcggggagtcctgaatagccctgtgaaggctgttcgtgacacgctcatcacccagtgtgcccagatcctggcctgttacagaaagaactgtgctagcccctcctctgcaggacagttgatccttcctgagtgcatgaagctactcccagtttacctgaactgtgtgttgaagagtgatgtcctgcagcctggagctgaagtcactactgatgaccgtgcctatgtccgacagctagttacctccatggatgtgactgagaccaatgtcttcttctaccctcggctcttacctttgacaaagtctcccgttgagagtactaccgaaccaccagcagttcgagcctctgaagagcgtctaagcaatggggatatatatttactggagaatgggctcaacctcttcctctgggtgggagcaagcgtccaacagggtgttgtccagagccttttcagcgtctcctccttcagtcagatcaccagtggtttgagtgttctgccagttctggataatccactgtccaagaaggttcgaggcctcattgatagcttacgggcacagagatcccggtacatgaagcttaccgtggtgaaacaggaagacaagatggagatgctgttcaagcacttcctggtggaagacaagagtctgagtgggggagcatcttatgtggactttctctgtcatatgcacaaggagattcggcagctactgagctaa
Sequence Length
3285
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,181 Da
NCBI Official Full Name
Homo sapiens SEC24 family, member C (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC24 homolog C, COPII coat complex component
NCBI Official Symbol
SEC24C
NCBI Protein Information
protein transport protein Sec24C
UniProt Protein Name
Protein transport protein Sec24C
Protein Family
UniProt Gene Name
SEC24C
UniProt Synonym Gene Names
KIAA0079
UniProt Entry Name
SC24C_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

SEC24C: Component of the COPII coat, that covers ER-derived vesicles involved in transport from the endoplasmic reticulum to the Golgi apparatus. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the Golgi complex. Interacts with SLC6A4. COPII is composed of at least five proteins: the Sec23/24 complex, the Sec13/31 complex and Sar1. SEC24C is capable of forming heterodimers with SEC24A. Interacts with TMED2 and TMED10. Ubiquitous. Belongs to the SEC23/SEC24 family. SEC24 subfamily.

Protein type: Motor

Chromosomal Location of Human Ortholog: 10q22.2

Cellular Component: cytosol; endoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport

Research Articles on SEC24C

Similar Products

Product Notes

The SEC24C sec24c (Catalog #AAA1274777) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgtca accagtcagt tccacctgtg ccaccatttg ggcagcccca gcccatctac ccagggtatc atcagtccag ctatggtggg caatcagggt ccacagcccc cgccattccc tatggagcct acaatggccc agtaccaggc tatcagcaaa cacctcccca aggtatgtca agagccccac cttcctcggg ggcacctcca gcctcaacag cacaggctcc ttgtggccag gctgcatatg gccagtttgg ccaaggagat gtacagaatg ggccaagctc cactgttcag atgcaaaggc tgcctgggtc tcagtcattt gggtccccat tggcccctgt gggcaaccag ccacctgtgc ttcagcccta tggccctccc ccgacaagtg cacaggtggc tacgcagctg tctggaatgc agatcagcgg tgctgtggcc ccagcccctc cttcttcagg gctgggcttt ggcccaccaa catcgctggc ttcagcctca ggaagtttcc ctaactctgg tctgtatggc tcctatcctc agggccaggc tcctcccctt agccaggccc aaggtcatcc tgggatccag actccccagc gatctgcccc atcacaggcc tccagcttca cacccccagc ttcagggggt cctcggctgc cttcgatgac tggtccactc ctgcctggac agagttttgg agggccctca gtgagccagc ccaaccatgt gtcttcacct cctcaagctc tgccccctgg cacccagatg actgggcccc tgggaccact gccacctatg cactccccgc agcagccagg ctatcagccc caacaaaatg gttccttcgg accagcccgg ggccctcagt ctaattatgg aggcccctac ccagcagcac ccacctttgg cagtcagcct gggcctcctc agccactgcc tcctaagcgc ctggaccctg atgccatccc aagccctatt caggtcattg aagatgacag gaacaaccgg ggtacagagc catttgttac tggagtacgg ggccaggtgc cacccttagt cactaccaac ttcctggtga aagaccaagg gaatgcaagt ccccgataca tccgatgtac atcctataat atcccttgca catctgacat ggctaagcag gctcaggtgc ccctggcagc agtcatcaaa ccgctggcaa ggctgccccc agaggaggct tcaccgtatg ttgtggacca tggggaatct ggccctttgc gctgcaaccg ctgcaaagca tacatgtgtc ccttcatgca gttcattgaa ggagggaggc gtttccagtg ctgtttttgc agctgtatca atgatgttcc cccccagtat tttcagcacc tggatcatac cggcaaacgt gtggatgctt atgaccgccc tgagctatcc ctgggctctt atgaattctt ggccactgta gattactgca agaacaataa gttccccagc cctcctgcct ttatcttcat gattgacgtc tcctacaatg ccatcaggac tggtcttgtt aggctcctct gtgaggagct caagtcactg ttagactttc tacctaggga gggtggggca gaagagtcag caatccgcgt tggctttgtc acctacaata aggtgctcca cttctataat gtgaagagct cattggccca gccacagatg atggttgtgt ctgatgtggc tgacatgttt gtgccactgc tggatggctt cctggtcaac gtcaatgagt ctcgggcagt tatcaccagc ttattggatc agattccaga aatgtttgca gacacaaggg aaacagagac agtatttgta ccagttatcc aggctggaat ggaggctctg aaggctgctg agtgtgcagg gaagctcttt ctattccata catccctgcc cattgcagag gccccaggga aactgaagaa cagagatgac aggaagctga tcaatacaga caaggagaag actctgttcc agcctcagac aggtgcctat cagaccctgg ccaaagagtg tgtggcccaa ggctgctgtg tagatctctt tctcttccct aaccagtatg tggatgtggc cacactctct gttgtgcccc agctcactgg tggctctgtc tacaaatatg cttcctttca ggtggagaac gaccaggagc ggttcctgag tgacctgcgt cgtgatgtcc agaaggttgt tggctttgat gctgtgatgc gggtccggac aagcactggt atccgtgctg tagatttctt tggagctttc tacatgagca acacgacaga tgtggagctg gctgggctag atggggacaa aacagtgact gtggagttca agcatgacga tcggctcaat gaagagagcg gagctctcct gcagtgtgcc ctgctttaca ccagctgtgc agggcagcgt cggctccgca tccataatct ggccctgaac tgctgcaccc agctggctga tctatatcga aactgtgaga ctgacacgct catcaactac atggccaagt ttgcatatcg gggagtcctg aatagccctg tgaaggctgt tcgtgacacg ctcatcaccc agtgtgccca gatcctggcc tgttacagaa agaactgtgc tagcccctcc tctgcaggac agttgatcct tcctgagtgc atgaagctac tcccagttta cctgaactgt gtgttgaaga gtgatgtcct gcagcctgga gctgaagtca ctactgatga ccgtgcctat gtccgacagc tagttacctc catggatgtg actgagacca atgtcttctt ctaccctcgg ctcttacctt tgacaaagtc tcccgttgag agtactaccg aaccaccagc agttcgagcc tctgaagagc gtctaagcaa tggggatata tatttactgg agaatgggct caacctcttc ctctgggtgg gagcaagcgt ccaacagggt gttgtccaga gccttttcag cgtctcctcc ttcagtcaga tcaccagtgg tttgagtgtt ctgccagttc tggataatcc actgtccaag aaggttcgag gcctcattga tagcttacgg gcacagagat cccggtacat gaagcttacc gtggtgaaac aggaagacaa gatggagatg ctgttcaagc acttcctggt ggaagacaag agtctgagtg ggggagcatc ttatgtggac tttctctgtc atatgcacaa ggagattcgg cagctactga gctaa. It is sometimes possible for the material contained within the vial of "SEC24C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.