Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPANXE cdna clone

SPANXE cDNA Clone

Synonyms
SPANXE; SPANXE cDNA Clone; SPANXE cdna clone
Ordering
For Research Use Only!
Sequence
atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagacctcgagtgggtactcagacccgcaacctgctccgaaaaaactaaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag
Sequence Length
294
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,982 Da
NCBI Official Full Name
Homo sapiens SPANX family, member E, mRNA
UniProt Protein Name
Sperm protein associated with the nucleus on the X chromosome C
UniProt Gene Name
SPANXC
UniProt Synonym Gene Names
SPANX-C
UniProt Entry Name
SPNXC_HUMAN

Uniprot Description

SPANXC: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family, which is located in a gene cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a protein that localizes to the nucleus and is expressed in highly metastatic cell lines, making the protein a potential diagnostic and prognostic marker. The protein belongs to a family of cancer/testis antigens and represents a potential target for cancer immunotherapy. [provided by RefSeq, Jul 2008]

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xq27.1

Cellular Component: nucleus

Molecular Function: protein binding

Similar Products

Product Notes

The SPANXE spanxc (Catalog #AAA1274694) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaaac aatccagtgc cggcggggtg aagaggagcg tcccctgtga ttccaacgag gccaacgaga tgatgccgga gacctcgagt gggtactcag acccgcaacc tgctccgaaa aaactaaaaa catctgagtc ctcgaccata ctagtggttc gctacaggag gaacgtgaaa agaacatctc cagaggaact gctgaatgac cacgcccgag agaacagaat caaccccctc caaatggagg aggaggaatt catggaaata atggttgaaa tacctgcaaa gtag. It is sometimes possible for the material contained within the vial of "SPANXE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.