Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DOM3Z cdna clone

DOM3Z cDNA Clone

Gene Names
DXO; NG6; RAI1; DOM3L; DOM3Z
Synonyms
DOM3Z; DOM3Z cDNA Clone; DOM3Z cdna clone
Ordering
For Research Use Only!
Sequence
atggatcccagggggaccaagagaggagctgagaagacagaggtagctgagcctcggaacaaactacctcgtccagcaccttctctgcccacagaccctgccctctactctgggccctttcctttctaccggcgcccttcggaactgggctgcttctccctggatgctcaacgccagtaccatggagatgcccgagccctgcgctactatagcccaccccccactaacggtccaggccccaactttgacctcagagacggatacccggatcgataccagccccgggacgaggaggtccaggaaaggctggaccacctgctgtgctggctcctggaacaccgaggccggttggaggggggtccaggctggctggcagaggccatagtgacgtggcgggggcacctgacaaaactgctgacgacaccgtatgagcggcaggagggctggcagctggcagcctcccggttccagggaacactatacctgagtgaagtggagacaccgaacgctcgggcccagaggcttgctcggccaccgctcctccgggagcttatgtacatgggatacaaatttgagcagtacatgtgtgcagacaaacctggaagctccccagacccctctggggaggttaacaccaacgtggccttctgctctgtgctacgcagccgcctgggaagccaccctctgctcttctcaggggaggtagactgcacagacccccaagccccatccacacagcccccaacctgctatgtggagctcaagacctccaaggagatgcacagccctggccaatggaggagtttctacagacacaagctcctgaaatggtgggctcagtcattcctcccaggggtcccgaatgttgttgctggcttccgtaacccagacggttttgtctcttccctcaagacctttcctaccatgaagatgtttgaatatgtcaggaatgaccgtgacggctggaatccctctgtgtgcatgaacttctgtgccgccttccttagctttgcccagagcacggttgtccaggatgaccccaggctcgttcatctcttctcttgggagcctggcggcccagtcaccgtgtctgtacaccaagatgcaccttacgccttcctgcccatatggtatgtggaagctatgactcaggacctcccatcaccccccaagactccctctcccaaatag
Sequence Length
1191
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,929 Da
NCBI Official Full Name
Homo sapiens dom-3 homolog Z (C. elegans), mRNA
NCBI Official Synonym Full Names
decapping exoribonuclease
NCBI Official Symbol
DXO
NCBI Official Synonym Symbols
NG6; RAI1; DOM3L; DOM3Z
NCBI Protein Information
decapping and exoribonuclease protein
UniProt Protein Name
Decapping and exoribonuclease protein
UniProt Gene Name
DXO
UniProt Synonym Gene Names
DOM3L; DOM3Z; NG6; DXO
UniProt Entry Name
DXO_HUMAN

NCBI Description

This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. The function of its protein product is unknown, but its ubiquitous expression and conservation in both simple and complex eukaryotes suggests that this may be a housekeeping gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DOM3Z: May possess pyrophosphohydrolase activity towards 5' triphosphorylated RNA. Belongs to the Dom3Z family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: 5'-3' exonuclease activity; magnesium ion binding; mRNA binding

Biological Process: metabolic process; mRNA catabolic process; RNA destabilization

Research Articles on DOM3Z

Similar Products

Product Notes

The DOM3Z dxo (Catalog #AAA1274676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatccca gggggaccaa gagaggagct gagaagacag aggtagctga gcctcggaac aaactacctc gtccagcacc ttctctgccc acagaccctg ccctctactc tgggcccttt cctttctacc ggcgcccttc ggaactgggc tgcttctccc tggatgctca acgccagtac catggagatg cccgagccct gcgctactat agcccacccc ccactaacgg tccaggcccc aactttgacc tcagagacgg atacccggat cgataccagc cccgggacga ggaggtccag gaaaggctgg accacctgct gtgctggctc ctggaacacc gaggccggtt ggaggggggt ccaggctggc tggcagaggc catagtgacg tggcgggggc acctgacaaa actgctgacg acaccgtatg agcggcagga gggctggcag ctggcagcct cccggttcca gggaacacta tacctgagtg aagtggagac accgaacgct cgggcccaga ggcttgctcg gccaccgctc ctccgggagc ttatgtacat gggatacaaa tttgagcagt acatgtgtgc agacaaacct ggaagctccc cagacccctc tggggaggtt aacaccaacg tggccttctg ctctgtgcta cgcagccgcc tgggaagcca ccctctgctc ttctcagggg aggtagactg cacagacccc caagccccat ccacacagcc cccaacctgc tatgtggagc tcaagacctc caaggagatg cacagccctg gccaatggag gagtttctac agacacaagc tcctgaaatg gtgggctcag tcattcctcc caggggtccc gaatgttgtt gctggcttcc gtaacccaga cggttttgtc tcttccctca agacctttcc taccatgaag atgtttgaat atgtcaggaa tgaccgtgac ggctggaatc cctctgtgtg catgaacttc tgtgccgcct tccttagctt tgcccagagc acggttgtcc aggatgaccc caggctcgtt catctcttct cttgggagcc tggcggccca gtcaccgtgt ctgtacacca agatgcacct tacgccttcc tgcccatatg gtatgtggaa gctatgactc aggacctccc atcacccccc aagactccct ctcccaaata g. It is sometimes possible for the material contained within the vial of "DOM3Z, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.