Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA4 cdna clone

SERPINA4 cDNA Clone

Gene Names
SERPINA4; KAL; KST; PI4; KLST; PI-4; kallistatin
Synonyms
SERPINA4; SERPINA4 cDNA Clone; SERPINA4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcttatcgactacctgctcctcctgctggttggactactggccctttctcatggccagctgcacgttgagcatgatggtgagagttgcagtaacagctcccaccagcagattctggagacaggtgagggctcccccagcctcaagatagcccctgccaatgctgactttgccttccgcttctactacctgatcgcttcggagaccccggggaagaacatctttttctccccgctgagcatctcggcggcctacgccatgctttccctgggggcctgctcacacagccgcagccagatccttgagggcctgggcttcaacctcaccgagctgtctgagtccgatgtccataggggcttccagcacctcctgcacactctcaacctccccggccatgggctggaaacacgcgtgggcagtgctctgttcctgagccacaacctgaagttccttgcaaaattcctgaatgacaccatggccgtctatgaggctaaactcttccacaccaacttctacgacactgtgggcacaatccagcttatcaacgaccacgtcaagaaggaaactcgagggaagattgtggatttggtcagtgagctcaagaaggacgtcttgatggtgctggtgaattacatttacttcaaagccctgtgggagaaaccattcatttcctcaaggaccactcccaaagacttttatgttgatgagaacacaacagtccgggtgcccatgatgctgcaggaccaggagcatcactggtatcttcatgacagatacttgccctgctcggtgctacggatggattacaaaggagacgcaaccgtgtttttcattctccctaaccaaggcaaaatgagggagattgaagaggttctgactccagagatgctaatgaggtggaacaacttgttgcggaagaggaatttttacaagaagctagagttgcatcttcccaagttctccatttctggctcctatgtattagatcagattttgcccaggctgggcttcacggatctgttctccaagtgggctgacttatccggcatcaccaaacagcaaaaactggaggcatccaaaagtttccacaaggccaccttggacgtggatgaggctggcaccgaggctgcagcagccaccagcttcgcgatcaaattcttctctgcccagaccaatcgccacatcctgcgattcaaccggcccttccttgtggtgatcttttccaccagcacccagagtgtcctctttctgggcaaggtcgtcgaccccacgaaaccatag
Sequence Length
1284
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,542 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4, mRNA
NCBI Official Synonym Full Names
serpin family A member 4
NCBI Official Symbol
SERPINA4
NCBI Official Synonym Symbols
KAL; KST; PI4; KLST; PI-4; kallistatin
NCBI Protein Information
kallistatin
UniProt Protein Name
Kallistatin
Protein Family
UniProt Gene Name
SERPINA4
UniProt Synonym Gene Names
KST; PI4; PI-4
UniProt Entry Name
KAIN_HUMAN

Uniprot Description

SERPINA4: Inhibits human amidolytic and kininogenase activities of tissue kallikrein. Inhibition is achieved by formation of an equimolar, heat- and SDS-stable complex between the inhibitor and the enzyme, and generation of a small C-terminal fragment of the inhibitor due to cleavage at the reactive site by tissue kallikrein. Belongs to the serpin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q32.13

Cellular Component: extracellular region; extracellular space

Biological Process: platelet degranulation

Research Articles on SERPINA4

Similar Products

Product Notes

The SERPINA4 serpina4 (Catalog #AAA1274546) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatctta tcgactacct gctcctcctg ctggttggac tactggccct ttctcatggc cagctgcacg ttgagcatga tggtgagagt tgcagtaaca gctcccacca gcagattctg gagacaggtg agggctcccc cagcctcaag atagcccctg ccaatgctga ctttgccttc cgcttctact acctgatcgc ttcggagacc ccggggaaga acatcttttt ctccccgctg agcatctcgg cggcctacgc catgctttcc ctgggggcct gctcacacag ccgcagccag atccttgagg gcctgggctt caacctcacc gagctgtctg agtccgatgt ccataggggc ttccagcacc tcctgcacac tctcaacctc cccggccatg ggctggaaac acgcgtgggc agtgctctgt tcctgagcca caacctgaag ttccttgcaa aattcctgaa tgacaccatg gccgtctatg aggctaaact cttccacacc aacttctacg acactgtggg cacaatccag cttatcaacg accacgtcaa gaaggaaact cgagggaaga ttgtggattt ggtcagtgag ctcaagaagg acgtcttgat ggtgctggtg aattacattt acttcaaagc cctgtgggag aaaccattca tttcctcaag gaccactccc aaagactttt atgttgatga gaacacaaca gtccgggtgc ccatgatgct gcaggaccag gagcatcact ggtatcttca tgacagatac ttgccctgct cggtgctacg gatggattac aaaggagacg caaccgtgtt tttcattctc cctaaccaag gcaaaatgag ggagattgaa gaggttctga ctccagagat gctaatgagg tggaacaact tgttgcggaa gaggaatttt tacaagaagc tagagttgca tcttcccaag ttctccattt ctggctccta tgtattagat cagattttgc ccaggctggg cttcacggat ctgttctcca agtgggctga cttatccggc atcaccaaac agcaaaaact ggaggcatcc aaaagtttcc acaaggccac cttggacgtg gatgaggctg gcaccgaggc tgcagcagcc accagcttcg cgatcaaatt cttctctgcc cagaccaatc gccacatcct gcgattcaac cggcccttcc ttgtggtgat cttttccacc agcacccaga gtgtcctctt tctgggcaag gtcgtcgacc ccacgaaacc atag. It is sometimes possible for the material contained within the vial of "SERPINA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.