Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PCGF2 cdna clone

PCGF2 cDNA Clone

Gene Names
PCGF2; MEL-18; RNF110; ZNF144
Synonyms
PCGF2; PCGF2 cDNA Clone; PCGF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgcaggtccataaaacccggccgctgctgagcatcaggtctgacaaaacacttcaagacattgtctacaaattggtccctgggctttttaaagatgagatgaaacggcggcgggatttctatgcagcgtaccccctgacggaggtccccaacggctccaatgaggaccgcggcgaggtcttggagcaggagaagggggctctgagtgatgatgagattgtcagcctctccatcgaattctacgaaggtgccagggaccgggacgagaagaagggccccctggagaatggggatggggacaaagagaaaacaggggtgcgcttcctgcgatgcccagcagccatgaccgtcatgcatcttgccaagtttctccgcaacaagatggatgtgcccagcaagtacaaggtggaggttctgtacgaggacgagccactgaaggaatactacaccctcatggacatcgcctacatctacccctggcggcggaacgggcctctccccctcaagtaccgtgtccagccagcctgcaagcggctcaccctagccacggtgcccaccccctccgagggcaccaacaccagcggggcgtccgagtgtgagtcagtcagcgacaaggctcccagccctgccaccctgccagccacctcctcctccctgcccagcccagccaccccatcccatggctctcccagttcccatgggcctccagccacccaccctacctcccccactcccccttcgacagccagtggggccaccacagctgccaacgggggtagcttgaactgcctgcagacaccatcctccaccagcagggggcgcaagatgactgtcaacggcgctcccgtgccccccttaacttga
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,788 Da
NCBI Official Full Name
Homo sapiens polycomb group ring finger 2, mRNA
NCBI Official Synonym Full Names
polycomb group ring finger 2
NCBI Official Symbol
PCGF2
NCBI Official Synonym Symbols
MEL-18; RNF110; ZNF144
NCBI Protein Information
polycomb group RING finger protein 2
UniProt Protein Name
Polycomb group RING finger protein 2
UniProt Gene Name
PCGF2
UniProt Synonym Gene Names
MEL18; RNF110; ZNF144
UniProt Entry Name
PCGF2_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]

Uniprot Description

PCGF2: Transcriptional repressor. Binds specifically to the DNA sequence 5'-GACTNGACT-3'. Has tumor suppressor activity. May play a role in control of cell proliferation and/or neural cell development. Regulates proliferation of early T progenitor cells by maintaining expression of HES1. Also plays a role in antero- posterior specification of the axial skeleton and negative regulation of the self-renewal activity of hematopoietic stem cells. Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. Is not functionally redundant with Bmi1; unlike Bmi1 does not stimulate the E3 ubiquitin-protein ligase activity in a reconstituted PRC1-like complex.

Protein type: Ubiquitin conjugating system; Ubiquitin ligase; Transcription factor

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: nuclear chromatin; nucleoplasm; nucleus; PcG protein complex

Molecular Function: protein binding; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; protein sumoylation

Research Articles on PCGF2

Similar Products

Product Notes

The PCGF2 pcgf2 (Catalog #AAA1274530) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcgga ctacacggat caaaatcaca gagctgaacc cccacctcat gtgtgccctc tgcggggggt acttcatcga cgccaccact atcgtggagt gcctgcattc cttctgcaaa acctgcatcg tgcgctacct ggagaccaac aaatactgcc ccatgtgtga cgtgcaggtc cataaaaccc ggccgctgct gagcatcagg tctgacaaaa cacttcaaga cattgtctac aaattggtcc ctgggctttt taaagatgag atgaaacggc ggcgggattt ctatgcagcg taccccctga cggaggtccc caacggctcc aatgaggacc gcggcgaggt cttggagcag gagaaggggg ctctgagtga tgatgagatt gtcagcctct ccatcgaatt ctacgaaggt gccagggacc gggacgagaa gaagggcccc ctggagaatg gggatgggga caaagagaaa acaggggtgc gcttcctgcg atgcccagca gccatgaccg tcatgcatct tgccaagttt ctccgcaaca agatggatgt gcccagcaag tacaaggtgg aggttctgta cgaggacgag ccactgaagg aatactacac cctcatggac atcgcctaca tctacccctg gcggcggaac gggcctctcc ccctcaagta ccgtgtccag ccagcctgca agcggctcac cctagccacg gtgcccaccc cctccgaggg caccaacacc agcggggcgt ccgagtgtga gtcagtcagc gacaaggctc ccagccctgc caccctgcca gccacctcct cctccctgcc cagcccagcc accccatccc atggctctcc cagttcccat gggcctccag ccacccaccc tacctccccc actccccctt cgacagccag tggggccacc acagctgcca acgggggtag cttgaactgc ctgcagacac catcctccac cagcaggggg cgcaagatga ctgtcaacgg cgctcccgtg ccccccttaa cttga. It is sometimes possible for the material contained within the vial of "PCGF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.