Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKRD1 cdna clone

ANKRD1 cDNA Clone

Gene Names
ANKRD1; ALRP; CARP; C-193; CVARP; MCARP; bA320F15.2
Synonyms
ANKRD1; ANKRD1 cDNA Clone; ANKRD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggtactgaaagtagaggaactggtcactggaaagaagaatggcaatggggaggcaggggaattccttcctgaggatttcagagatggagagtatgaagctgctgttactttagagaagcaggaggatctgaagacacttctagcccaccctgtgaccctgggggagcaacagtggaaaagcgagaaacaacgagaggcagagctcaaaaagaaaaaactagaacaaagatcaaagcttgaaaatttagaagaccttgaaataatcattcaactgaagaaaaggaaaaaatacaggaaaactaaagttccagttgtaaaggaaccagaacctgaaatcattacggaacctgtggatgtgcctacgtttctgaaggctgctctggagaataaactgccagtagtagaaaaattcttgtcagacaagaacaatccagatgtttgtgatgagtataaacggacagctcttcatagagcatgcttggaaggacatttggcaattgtggagaagttaatggaagctggagcccagatcgaattccgtgatatgcttgaatccacagccatccactgggcaagccgtggaggaaacctggatgttttaaaattgttgctgaataaaggagcaaaaattagcgcccgagataagttgctcagcacagcgctgcatgtggcggtgaggactggccactatgagtgcgcggagcatcttatcgcctgtgaggcagacctcaacgccaaagacagagaaggagataccccgttgcatgatgcggtgagactgaaccgctataagatgatccgactcctgattatgtatggcgcggatctcaacatcaagaactgtgctgggaagacgccgatggatctggtgctacactggcagaatggaaccaaagcaatattcgacagcctcagagagaactcctacaagacctctcgcatagctacattctga
Sequence Length
960
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,252 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 1 (cardiac muscle), mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 1
NCBI Official Symbol
ANKRD1
NCBI Official Synonym Symbols
ALRP; CARP; C-193; CVARP; MCARP; bA320F15.2
NCBI Protein Information
ankyrin repeat domain-containing protein 1
UniProt Protein Name
Ankyrin repeat domain-containing protein 1
UniProt Gene Name
ANKRD1
UniProt Synonym Gene Names
C193; CARP; HA1A2
UniProt Entry Name
ANKR1_HUMAN

NCBI Description

The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]

Uniprot Description

ANKRD1: May play an important role in endothelial cell activation. May act as a nuclear transcription factor that negatively regulates the expression of cardiac genes. Induction seems to be correlated with apoptotic cell death in hepatoma cells. Defects in ANKRD1 may be a cause of total anomalous pulmonary venous return (TAPVR). TAPVR is a rare congenital heart disease (CHD) in which the pulmonary veins fail to connect to the left atrium during cardiac development, draining instead into either the right atrium or one of its venous tributaries. This disease accounts for 1.5% of all CHDs and has a prevalence of approximately 1 out of 15'000 live births.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 10q23.31

Cellular Component: cytoplasm; cytosol; I band; nucleolus; nucleoplasm; nucleus; sarcomere

Molecular Function: DNA binding; histone deacetylase binding; p53 binding; protein binding; titin binding; transcription corepressor activity

Biological Process: cardiac muscle morphogensis; muscle cell differentiation; positive regulation of apoptosis; positive regulation of DNA damage response, signal transduction by p53 class mediator; positive regulation of protein secretion

Research Articles on ANKRD1

Similar Products

Product Notes

The ANKRD1 ankrd1 (Catalog #AAA1274506) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggtac tgaaagtaga ggaactggtc actggaaaga agaatggcaa tggggaggca ggggaattcc ttcctgagga tttcagagat ggagagtatg aagctgctgt tactttagag aagcaggagg atctgaagac acttctagcc caccctgtga ccctggggga gcaacagtgg aaaagcgaga aacaacgaga ggcagagctc aaaaagaaaa aactagaaca aagatcaaag cttgaaaatt tagaagacct tgaaataatc attcaactga agaaaaggaa aaaatacagg aaaactaaag ttccagttgt aaaggaacca gaacctgaaa tcattacgga acctgtggat gtgcctacgt ttctgaaggc tgctctggag aataaactgc cagtagtaga aaaattcttg tcagacaaga acaatccaga tgtttgtgat gagtataaac ggacagctct tcatagagca tgcttggaag gacatttggc aattgtggag aagttaatgg aagctggagc ccagatcgaa ttccgtgata tgcttgaatc cacagccatc cactgggcaa gccgtggagg aaacctggat gttttaaaat tgttgctgaa taaaggagca aaaattagcg cccgagataa gttgctcagc acagcgctgc atgtggcggt gaggactggc cactatgagt gcgcggagca tcttatcgcc tgtgaggcag acctcaacgc caaagacaga gaaggagata ccccgttgca tgatgcggtg agactgaacc gctataagat gatccgactc ctgattatgt atggcgcgga tctcaacatc aagaactgtg ctgggaagac gccgatggat ctggtgctac actggcagaa tggaaccaaa gcaatattcg acagcctcag agagaactcc tacaagacct ctcgcatagc tacattctga. It is sometimes possible for the material contained within the vial of "ANKRD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.