Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASRGL1 cdna clone

ASRGL1 cDNA Clone

Gene Names
ASRGL1; ALP; ALP1; CRASH
Synonyms
ASRGL1; ASRGL1 cDNA Clone; ASRGL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggttccagagattcctggagaaaaactggtgacagagagaaacaaaaagcgcctggaaaaagagaagcatgaaaaaggtgctcagaaaacagattgtcaaaaaaacttgggaaccgtgggtgctgttgccttggactgcaaagggaatgtagcctacgcaacctccacaggcggtatcgttaataaaatggtcggccgcgttggggactcaccgtgtctaggagctggaggttatgccgacaatgacatcggagccgtctcaaccacagggcatggggaaagcatcctgaaggtgaacctggctagactcaccctgttccacatagaacaaggaaagacggtagaagaggctgcggacctatcgttgggttatatgaagtcaagggttaaaggtttaggtggcctcatcgtggttagcaaaacaggagactgggtggcaaagtggacctccacctccatgccctgggcagccgccaaggacggcaagctgcacttcggaattgatcctgacgatactactatcaccgaccttccctaa
Sequence Length
543
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,981 Da
NCBI Official Full Name
Homo sapiens asparaginase like 1, mRNA
NCBI Official Synonym Full Names
asparaginase like 1
NCBI Official Symbol
ASRGL1
NCBI Official Synonym Symbols
ALP; ALP1; CRASH
NCBI Protein Information
isoaspartyl peptidase/L-asparaginase
UniProt Protein Name
Isoaspartyl peptidase/L-asparaginase
UniProt Gene Name
ASRGL1
UniProt Synonym Gene Names
ALP; CRASH
UniProt Entry Name
ASGL1_HUMAN

Uniprot Description

ASRGL1: Acts in asparagine catabolism. May be involved in astroglial production of L-aspartate, which can act as an excitatory neurotransmitter in some brain regions. Belongs to the Ntn-hydrolase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.19.5; Hydrolase; Other Amino Acids Metabolism - cyanoamino acid; EC 3.5.1.1; Amino Acid Metabolism - alanine, aspartate and glutamate; Energy Metabolism - nitrogen

Chromosomal Location of Human Ortholog: 11q12.3

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: asparaginase activity; beta-aspartyl-peptidase activity; N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity

Biological Process: asparagine catabolic process via L-aspartate; L-phenylalanine catabolic process

Research Articles on ASRGL1

Similar Products

Product Notes

The ASRGL1 asrgl1 (Catalog #AAA1274484) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggttc cagagattcc tggagaaaaa ctggtgacag agagaaacaa aaagcgcctg gaaaaagaga agcatgaaaa aggtgctcag aaaacagatt gtcaaaaaaa cttgggaacc gtgggtgctg ttgccttgga ctgcaaaggg aatgtagcct acgcaacctc cacaggcggt atcgttaata aaatggtcgg ccgcgttggg gactcaccgt gtctaggagc tggaggttat gccgacaatg acatcggagc cgtctcaacc acagggcatg gggaaagcat cctgaaggtg aacctggcta gactcaccct gttccacata gaacaaggaa agacggtaga agaggctgcg gacctatcgt tgggttatat gaagtcaagg gttaaaggtt taggtggcct catcgtggtt agcaaaacag gagactgggt ggcaaagtgg acctccacct ccatgccctg ggcagccgcc aaggacggca agctgcactt cggaattgat cctgacgata ctactatcac cgaccttccc taa. It is sometimes possible for the material contained within the vial of "ASRGL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.