CLASP1 cdna clone

CLASP1 cDNA Clone

Cat. Num. AAA1274446

• Gene Names: CLASP1; MAST1
• Synonyms: CLASP1; CLASP1 cDNA Clone; CLASP1 cdna clone

• Sequence: atgaagactctggaagcccacaaagactcccataaggaggtggtgagagcggctgaggaggctgcgtccacactggccagttccatccacccggagcagtgcatcaaggtgctctgccccatcatccagacggccgactaccccatcaaccttgctgccatcaagatgcagaccaaagtcgtcgagaggatcgcaaaggagtcattgctgcagctccttgtcgacatcatcccaggcttgctgcagggttatgacaacaccgaaagtagtgtgcgtaaggccagcgtgttttgcttagtggcaatttattccgtaatcggagaagacctgaaacctcaccttgcacagctcacagggagcaagatgaagctactaaacttatacataaagagggcccagaccaccaacagcaacagcagctcctcctccgatgtctccacgcacagctaa
• Sequence Length: 450

• Vector: pENTR223.1
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 21619135
• NCBI GeneID: 23332
• Molecular Weight: 162,914 Da
• NCBI Official Full Name: Homo sapiens cytoplasmic linker associated protein 1, mRNA
• NCBI Official Synonym Full Names: cytoplasmic linker associated protein 1
• NCBI Official Symbol: CLASP1
• NCBI Official Synonym Symbols: MAST1
• NCBI Protein Information: CLIP-associating protein 1
• UniProt Protein Name: CLIP-associating protein 1
• Protein Family: CLIP-associating protein
• UniProt Gene Name: CLASP1
• UniProt Synonym Gene Names: KIAA0622; MAST1; hOrbit1
• UniProt Entry Name: CLAP1_HUMAN

NCBI Description

CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]

Uniprot Description

CLASP1: Microtubule plus-end tracking protein that promotes the stabilization of dynamic microtubules. Involved in the nucleation of noncentrosomal microtubules originating from the trans-Golgi network (TGN). Required for the polarization of the cytoplasmic microtubule arrays in migrating cells towards the leading edge of the cell. May act at the cell cortex to enhance the frequency of rescue of depolymerizing microtubules by attaching their plus-ends to cortical platforms composed of ERC1 and PHLDB2. This cortical microtubule stabilizing activity is regulated at least in part by phosphatidylinositol 3-kinase signaling. Also performs a similar stabilizing function at the kinetochore which is essential for the bipolar alignment of chromosomes on the mitotic spindle. Belongs to the CLASP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q14.2-q14.3

Cellular Component: basal cortex; cell cortex; centrosome; cortical microtubule cytoskeleton; cytoplasmic microtubule; cytosol; focal adhesion; Golgi apparatus; kinetochore; kinetochore microtubule; membrane; spindle microtubule

Molecular Function: kinetochore binding; microtubule binding; microtubule plus-end binding; protein binding

Biological Process: astral microtubule organization and biogenesis; cell division; establishment of mitotic spindle localization; establishment of spindle orientation; exit from mitosis; G2/M transition of mitotic cell cycle; Golgi organization and biogenesis; microtubule bundle formation; microtubule cytoskeleton organization and biogenesis; microtubule nucleation; microtubule organizing center organization and biogenesis; mitotic spindle organization and biogenesis; negative regulation of microtubule depolymerization; negative regulation of microtubule polymerization or depolymerization; negative regulation of stress fiber formation; positive regulation of exocytosis; positive regulation of microtubule polymerization; regulation of focal adhesion formation; regulation of gastrulation; sister chromatid cohesion; vesicle targeting