Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35A5 cdna clone

SLC35A5 cDNA Clone

Synonyms
SLC35A5; SLC35A5 cDNA Clone; SLC35A5 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaaacagtgctgtagtcatcctgtaatatgctccttgtcaacaatgtatacattcctgctaggtgccatattcattgctttaagctcaagtcgcatcttactagtgaagtattctgccaatgaagaaaacaagtatgattatcttccaactactgtgaatgtgtgctcagaactggtgaagctagttttctgtgtgcttgtgtcattctgtgttataaagaaagatcatcaaagtagaaatttgaaatatgcttcctggaaggaattctctgatttcatgaagtggtccattcctgcctttctttatttcctggataacttgattgtcttctatgtcctgtcctatcttcaaccagccatggctgttatcttctcaaattttagcattataacaacagctcttctattcaggatagtgctgaagaggcgtctaaactggatccagtgggcttccctcctgactttatttttgtctattgtggccttgactgccgggactaaaactttacagcacaacttggcaggacgtggatttcatcacgatgcctttttcagcccttccaattcctgccttcttttcagaagtgagtgtcccagaaaagacaattgtacagcaaaggaatggacttttcctgaagctaaatggaacaccacagccagagttttcagtcacatccgtcttggcatgggccatgttcttattatagtccagtgttttatttcttcaatggctaatatctataatgaaaagatactgaaggaagggaaccagctcactgaaagcatcttcatacagaacagcaaactctatttctttggcattctgtttaatgggctgactctgggccttcagaggagtaaccgtgatcagattaagaactgtggatttttttatggccacagtgcattttcagtagcccttatttttgtaactgcattccagggcctttcagtggctttcattctgaagttcctggataacatgttccatgtcttgatggcccaggttaccactgtcattatcacaacagtgtctgtcctggtctttgacttcaggccctccctggaatttttcttggaagccccatcagtccttctctctatatttatttataatgccagcaagcctcaagttccggaatacgcacctaggcaagaaaggatccgagatctaagtggcaatctttgggagcgttccagtggggatggagaagaactagaaagacttaccaaacccaagagtgatgagtcagatgaagatactttctaa
Sequence Length
1275
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,500 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35, member A5, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member A5
NCBI Official Symbol
SLC35A5
NCBI Protein Information
probable UDP-sugar transporter protein SLC35A5
UniProt Protein Name
Probable UDP-sugar transporter protein SLC35A5
UniProt Gene Name
SLC35A5
UniProt Entry Name
S35A5_HUMAN

Uniprot Description

SLC35A5: Belongs to the nucleotide-sugar transporter family. SLC35A subfamily.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 3q13.2

Similar Products

Product Notes

The SLC35A5 slc35a5 (Catalog #AAA1274437) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaac agtgctgtag tcatcctgta atatgctcct tgtcaacaat gtatacattc ctgctaggtg ccatattcat tgctttaagc tcaagtcgca tcttactagt gaagtattct gccaatgaag aaaacaagta tgattatctt ccaactactg tgaatgtgtg ctcagaactg gtgaagctag ttttctgtgt gcttgtgtca ttctgtgtta taaagaaaga tcatcaaagt agaaatttga aatatgcttc ctggaaggaa ttctctgatt tcatgaagtg gtccattcct gcctttcttt atttcctgga taacttgatt gtcttctatg tcctgtccta tcttcaacca gccatggctg ttatcttctc aaattttagc attataacaa cagctcttct attcaggata gtgctgaaga ggcgtctaaa ctggatccag tgggcttccc tcctgacttt atttttgtct attgtggcct tgactgccgg gactaaaact ttacagcaca acttggcagg acgtggattt catcacgatg cctttttcag cccttccaat tcctgccttc ttttcagaag tgagtgtccc agaaaagaca attgtacagc aaaggaatgg acttttcctg aagctaaatg gaacaccaca gccagagttt tcagtcacat ccgtcttggc atgggccatg ttcttattat agtccagtgt tttatttctt caatggctaa tatctataat gaaaagatac tgaaggaagg gaaccagctc actgaaagca tcttcataca gaacagcaaa ctctatttct ttggcattct gtttaatggg ctgactctgg gccttcagag gagtaaccgt gatcagatta agaactgtgg atttttttat ggccacagtg cattttcagt agcccttatt tttgtaactg cattccaggg cctttcagtg gctttcattc tgaagttcct ggataacatg ttccatgtct tgatggccca ggttaccact gtcattatca caacagtgtc tgtcctggtc tttgacttca ggccctccct ggaatttttc ttggaagccc catcagtcct tctctctata tttatttata atgccagcaa gcctcaagtt ccggaatacg cacctaggca agaaaggatc cgagatctaa gtggcaatct ttgggagcgt tccagtgggg atggagaaga actagaaaga cttaccaaac ccaagagtga tgagtcagat gaagatactt tctaa. It is sometimes possible for the material contained within the vial of "SLC35A5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.