Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCAR cdna clone

FCAR cDNA Clone

Gene Names
FCAR; CD89; FcalphaRI; CTB-61M7.2
Synonyms
FCAR; FCAR cDNA Clone; FCAR cdna clone
Ordering
For Research Use Only!
Sequence
atggaccccaaacagaccaccctcctgtgtcttgtgctctgtctgggccagaggattcaggcacaggaaggggactttcccatgcctttcatatctgccaaatcgagtcctgtgattcccttggatggatctgtgaaaatccagtgccaggccattcgtgaagcttacctgacccagctgatgatcataaaaaactccacgtaccgagagataggcagaagactgaagttttggaatgagactgatcctgagttcgtcattgaccacatggacgcaaacaaggcagggcgctatcagtgccaatataggatagggcactacagattccggtacagtgacaccctggagctggtagtgacaggcttgtatggcaaacccttcctctctgcagatcggggtctggtgttgatgccaggagagaatatttccctcacgtgcagctcagcacacatcccatttgatagattttcactggccaaggagggagaactttctctgccacagcaccaaagtggggaacacccggccaacttctctttgggtcctgtggacctcaatgtctcagggatctacaggtgctacggttggtacaacaggagcccctacctgtggtccttccccagtaatgccttggagcttgtggtcacagactccatccaccaagattacacgacgcagaacttgatccgcatggccgtggcaggactggtcctcgtggctctcttggccatactggttgaaaattggcacagccatacggcactgaacaaggaagcctcggcagatgtggctgaaccgagctggagccaacagatgtgtcagccaggattgacctttgcacgaacaccaagtgtctgcaagtaa
Sequence Length
864
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,343 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgA, receptor for, mRNA
NCBI Official Synonym Full Names
Fc fragment of IgA receptor
NCBI Official Symbol
FCAR
NCBI Official Synonym Symbols
CD89; FcalphaRI; CTB-61M7.2
NCBI Protein Information
immunoglobulin alpha Fc receptor
UniProt Protein Name
Immunoglobulin alpha Fc receptor
UniProt Gene Name
FCAR
UniProt Synonym Gene Names
CD89; IgA Fc receptor
UniProt Entry Name
FCAR_HUMAN

NCBI Description

This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

FCAR: Binds to the Fc region of immunoglobulins alpha. Mediates several functions including cytokine production. 11 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Immunoglobulin superfamily

Chromosomal Location of Human Ortholog: 19q13.42

Cellular Component: integral to plasma membrane; plasma membrane

Biological Process: immune response

Research Articles on FCAR

Similar Products

Product Notes

The FCAR fcar (Catalog #AAA1274357) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccca aacagaccac cctcctgtgt cttgtgctct gtctgggcca gaggattcag gcacaggaag gggactttcc catgcctttc atatctgcca aatcgagtcc tgtgattccc ttggatggat ctgtgaaaat ccagtgccag gccattcgtg aagcttacct gacccagctg atgatcataa aaaactccac gtaccgagag ataggcagaa gactgaagtt ttggaatgag actgatcctg agttcgtcat tgaccacatg gacgcaaaca aggcagggcg ctatcagtgc caatatagga tagggcacta cagattccgg tacagtgaca ccctggagct ggtagtgaca ggcttgtatg gcaaaccctt cctctctgca gatcggggtc tggtgttgat gccaggagag aatatttccc tcacgtgcag ctcagcacac atcccatttg atagattttc actggccaag gagggagaac tttctctgcc acagcaccaa agtggggaac acccggccaa cttctctttg ggtcctgtgg acctcaatgt ctcagggatc tacaggtgct acggttggta caacaggagc ccctacctgt ggtccttccc cagtaatgcc ttggagcttg tggtcacaga ctccatccac caagattaca cgacgcagaa cttgatccgc atggccgtgg caggactggt cctcgtggct ctcttggcca tactggttga aaattggcac agccatacgg cactgaacaa ggaagcctcg gcagatgtgg ctgaaccgag ctggagccaa cagatgtgtc agccaggatt gacctttgca cgaacaccaa gtgtctgcaa gtaa. It is sometimes possible for the material contained within the vial of "FCAR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.