Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP2R5D cdna clone

PPP2R5D cDNA Clone

Gene Names
PPP2R5D; B56D; MRD35
Synonyms
PPP2R5D; PPP2R5D cDNA Clone; PPP2R5D cdna clone
Ordering
For Research Use Only!
Sequence
atgccctataaactgaaaaaggagaaggagccccccaaggttgccaaatgcacagccaagcctagcagctcgggcaaggatggtggaggcgagaacactgaggaggcccagccgcagccccagccccagccccagccccaagcccagtctcagccaccgtcatccaacaagcgtcccagcaatagcacgccgccccccacgcagctcagcaaaatcaagtactcaggggggccccagattgtcaagaaggagcgacggcaaagctcctcccgcttcaacctcagcaagaatcgggagctgcagaagcttcctgccctgaaagattcgccaacccaggagcgggaggagctgtttatccagaagctacgccagtgctgtgtcctctttgacttcgtgtcagacccactcagtgacctcaaattcaaggaggtgaagcgggcaggactcaacgagatggtggagtacatcacccatagccgtgatgttgtcactgaggccatttaccctgaggctgtcaccatgttttcagtgaacctcttccggacgctgccaccttcatcgaatcccacaggggctgagtttgacccagaggaagatgagcccaccctggaagctgcttggccacatctccagctcgtgtatgagttcttcttacgtttccttgagtctcctgatttccagccaaacatagccaagaagtacatcgaccagaagtttgtacttgctctcctagacctatttgacagtgaggatcctcgagagcgggacttcctcaagaccattttgcatcgcatctatggcaagtttttggggctccgggcttatatccgtaggcagatcaaccacatcttctacaggttcatctacgagacggagcatcacaacgggattgctgagctcctggagatcctgggcagcatcatcaatggctttgccctgccccttaaagaagagcacaagatgttcctcatccgtgtcctacttccccttcacaaggtcaagtccctgagtgtctaccaccctcagctggcatactgtgtggtacaattcctggagaaggagagcagtctgactgagccggtaattgtgggacttctcaagttttggcccaagacccacagccccaaggaggtgatgttcttgaatgagctggaggagattctggacgtcattgaaccttctgagttcagcaaagtgatggaacccctcttccgccagctggccaagtgtgtctctagcccccatttccaggtggcagagcgtgctctctattactggaacaatgagtacatcatgagcctgataagtgacaatgctgcccgagtcctccccatcatgttccctgcactctacaggaactccaagagccactggaacaagacaatccatggactgatctataatgccctgaagttgtttatggaaatgaatcagaagctgtttgatgactgcacacaacaatacaaggcagagaagcagaagggccggttccgaatgaaggaaagggaagagatgtggcaaaaaatcgaggagctggcccggcttaatccccagtatcccatgttccgagcccctccaccactgccccctgtgtactcgatggagacagagacccccacagctgaggacatccagcttctgaagaggactgtggagactgaggctgttcagatgctaaaagacatcaagaaggagaaagtgctgctgcggaggaagtcggagctgccccaggacgtgtacaccatcaaggcactggaggcgcacaagcgggcggaagagttcctaactgccagccaggaggctctctga
Sequence Length
1809
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,453 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2, regulatory subunit B', delta isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 regulatory subunit B'delta
NCBI Official Symbol
PPP2R5D
NCBI Official Synonym Symbols
B56D; MRD35
NCBI Protein Information
serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform
UniProt Gene Name
PPP2R5D
UniProt Entry Name
2A5D_HUMAN

NCBI Description

The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

PPP2R5D: The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. PP2A consists of a common heterodimeric core enzyme, composed of a 36 kDa catalytic subunit (subunit C) and a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B''/PR72/PR130/PR59 and R5/B'/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules. Interacts with SGOL1. By retinoic acid; in neuroblastoma cell lines. Isoform Delta-2 is widely expressed. Isoform Delta-1 is highly expressed in brain. Belongs to the phosphatase 2A regulatory subunit B56 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: protein binding; protein serine/threonine phosphatase activity

Biological Process: nervous system development

Disease: Mental Retardation, Autosomal Dominant 35

Research Articles on PPP2R5D

Similar Products

Product Notes

The PPP2R5D ppp2r5d (Catalog #AAA1274351) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctata aactgaaaaa ggagaaggag ccccccaagg ttgccaaatg cacagccaag cctagcagct cgggcaagga tggtggaggc gagaacactg aggaggccca gccgcagccc cagccccagc cccagcccca agcccagtct cagccaccgt catccaacaa gcgtcccagc aatagcacgc cgccccccac gcagctcagc aaaatcaagt actcaggggg gccccagatt gtcaagaagg agcgacggca aagctcctcc cgcttcaacc tcagcaagaa tcgggagctg cagaagcttc ctgccctgaa agattcgcca acccaggagc gggaggagct gtttatccag aagctacgcc agtgctgtgt cctctttgac ttcgtgtcag acccactcag tgacctcaaa ttcaaggagg tgaagcgggc aggactcaac gagatggtgg agtacatcac ccatagccgt gatgttgtca ctgaggccat ttaccctgag gctgtcacca tgttttcagt gaacctcttc cggacgctgc caccttcatc gaatcccaca ggggctgagt ttgacccaga ggaagatgag cccaccctgg aagctgcttg gccacatctc cagctcgtgt atgagttctt cttacgtttc cttgagtctc ctgatttcca gccaaacata gccaagaagt acatcgacca gaagtttgta cttgctctcc tagacctatt tgacagtgag gatcctcgag agcgggactt cctcaagacc attttgcatc gcatctatgg caagtttttg gggctccggg cttatatccg taggcagatc aaccacatct tctacaggtt catctacgag acggagcatc acaacgggat tgctgagctc ctggagatcc tgggcagcat catcaatggc tttgccctgc cccttaaaga agagcacaag atgttcctca tccgtgtcct acttcccctt cacaaggtca agtccctgag tgtctaccac cctcagctgg catactgtgt ggtacaattc ctggagaagg agagcagtct gactgagccg gtaattgtgg gacttctcaa gttttggccc aagacccaca gccccaagga ggtgatgttc ttgaatgagc tggaggagat tctggacgtc attgaacctt ctgagttcag caaagtgatg gaacccctct tccgccagct ggccaagtgt gtctctagcc cccatttcca ggtggcagag cgtgctctct attactggaa caatgagtac atcatgagcc tgataagtga caatgctgcc cgagtcctcc ccatcatgtt ccctgcactc tacaggaact ccaagagcca ctggaacaag acaatccatg gactgatcta taatgccctg aagttgttta tggaaatgaa tcagaagctg tttgatgact gcacacaaca atacaaggca gagaagcaga agggccggtt ccgaatgaag gaaagggaag agatgtggca aaaaatcgag gagctggccc ggcttaatcc ccagtatccc atgttccgag cccctccacc actgccccct gtgtactcga tggagacaga gacccccaca gctgaggaca tccagcttct gaagaggact gtggagactg aggctgttca gatgctaaaa gacatcaaga aggagaaagt gctgctgcgg aggaagtcgg agctgcccca ggacgtgtac accatcaagg cactggaggc gcacaagcgg gcggaagagt tcctaactgc cagccaggag gctctctga. It is sometimes possible for the material contained within the vial of "PPP2R5D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.