Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TARBP2 cdna clone

TARBP2 cDNA Clone

Gene Names
TARBP2; LOQS; TRBP; TRBP1; TRBP2
Synonyms
TARBP2; TARBP2 cDNA Clone; TARBP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaagaggagcaaggctccggcactaccacgggctgcgggctgcctagtatagagcaaatgctggccgccaacccaggcaagaccccgatcagccttctgcaggagtatgggaccagaatagggaagacgcctgtgtacgaccttctcaaagccgagggccaagcccaccagcctaatttcaccttccgggtcaccgttggcgacaccagctgcactggtcagggccccagcaagaaggcagccaagcacaaggcagctgaggtggccctcaaacacctcaaaggggggagcatgctggagccggccctggaggacagcagttctttttctcccctagactcttcactgcctgaggacattccggtttttactgctgcagcagctgctaccccagttccatctgtagtcctaaccaggagcccccccatggaactgcagccccctgtctcccctcagcagtctgagtgcaaccccgttggtgctctgcaggagctggtggtgcagaaaggctggcggttgccggagtacacagtgacccaggagtctgggccagcccaccgcaaagaattcaccatgacctgtcgagtggagcgtttcattgagattgggagtggcacttccaaaaaattggcaaagcggaatgcggcggccaaaatgctgcttcgagtgcacacggtgcctctggatgcccgggatggcaatgaggtggagcctgatgatgaccacttctccattggtgtgggctcccgcctggatggtcttcgaaaccggggcccaggttgcacctgggattctctacgaaattcagtaggagagaagatcctgtccctccgcagttgctccctgggctccctgggtgccctgggccctgcctgctgccgtgtcctcagtgagctctctgaggagcaggcctttcacgtcagctacctggatattgaggagctgagcctgagtggactctgccagtgcctggtggaactgtccacccagccggccactgtgtgtcatggctctgcaaccaccagggaggcagcccgtggtgaggctgcccgccgtgccctgcagtacctcaagatcatggcaggcagcaagtga
Sequence Length
1101
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,916 Da
NCBI Official Full Name
Homo sapiens TAR (HIV-1) RNA binding protein 2, mRNA
NCBI Official Synonym Full Names
TARBP2, RISC loading complex RNA binding subunit
NCBI Official Symbol
TARBP2
NCBI Official Synonym Symbols
LOQS; TRBP; TRBP1; TRBP2
NCBI Protein Information
RISC-loading complex subunit TARBP2
UniProt Protein Name
RISC-loading complex subunit TARBP2
Protein Family
UniProt Gene Name
TARBP2
UniProt Entry Name
TRBP2_HUMAN

NCBI Description

HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene binds between the bulge and the loop of the HIV-1 TAR RNA regulatory element and activates HIV-1 gene expression in synergy with the viral Tat protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene also has a pseudogene. [provided by RefSeq, Jul 2008]

Uniprot Description

TRBP: the HIV-1 TAR RNA binding protein (TRBP) is a double strand RNA binding protein (dsRBP) that is required for the recruitment of Ago2 to the small interfering RNA (siRNA) bound by Dicer. TRBP increases HIV-1 expression and replication by inhibiting the interferon-induced protein kinase PKR and by increasing translation of viral mRNA. Dicer, Ago2, and TRBP are the main components of the RNA-induced silencing complex (RISC).

Protein type: Translation; RNA processing; Motility/polarity/chemotaxis; RNA-binding

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: double-stranded RNA binding; enzyme binding; protein binding; protein homodimerization activity; protein N-terminus binding; siRNA binding

Biological Process: miRNA-mediated gene silencing, miRNA loading onto RISC; miRNA-mediated gene silencing, production of miRNAs; negative regulation of defense response to virus by host; negative regulation of protein kinase activity; positive regulation of viral genome replication; pre-microRNA processing; regulation of viral transcription; RNA interference, production of siRNA; RNA interference, siRNA loading onto RISC; RNA interference, targeting of mRNA for destruction; RNA-mediated gene silencing

Research Articles on TARBP2

Similar Products

Product Notes

The TARBP2 tarbp2 (Catalog #AAA1274258) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaag aggagcaagg ctccggcact accacgggct gcgggctgcc tagtatagag caaatgctgg ccgccaaccc aggcaagacc ccgatcagcc ttctgcagga gtatgggacc agaataggga agacgcctgt gtacgacctt ctcaaagccg agggccaagc ccaccagcct aatttcacct tccgggtcac cgttggcgac accagctgca ctggtcaggg ccccagcaag aaggcagcca agcacaaggc agctgaggtg gccctcaaac acctcaaagg ggggagcatg ctggagccgg ccctggagga cagcagttct ttttctcccc tagactcttc actgcctgag gacattccgg tttttactgc tgcagcagct gctaccccag ttccatctgt agtcctaacc aggagccccc ccatggaact gcagccccct gtctcccctc agcagtctga gtgcaacccc gttggtgctc tgcaggagct ggtggtgcag aaaggctggc ggttgccgga gtacacagtg acccaggagt ctgggccagc ccaccgcaaa gaattcacca tgacctgtcg agtggagcgt ttcattgaga ttgggagtgg cacttccaaa aaattggcaa agcggaatgc ggcggccaaa atgctgcttc gagtgcacac ggtgcctctg gatgcccggg atggcaatga ggtggagcct gatgatgacc acttctccat tggtgtgggc tcccgcctgg atggtcttcg aaaccggggc ccaggttgca cctgggattc tctacgaaat tcagtaggag agaagatcct gtccctccgc agttgctccc tgggctccct gggtgccctg ggccctgcct gctgccgtgt cctcagtgag ctctctgagg agcaggcctt tcacgtcagc tacctggata ttgaggagct gagcctgagt ggactctgcc agtgcctggt ggaactgtcc acccagccgg ccactgtgtg tcatggctct gcaaccacca gggaggcagc ccgtggtgag gctgcccgcc gtgccctgca gtacctcaag atcatggcag gcagcaagtg a. It is sometimes possible for the material contained within the vial of "TARBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.