Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEFF1 cdna clone

TMEFF1 cDNA Clone

Gene Names
TMEFF1; TR-1; H7365; C9orf2; CT120.1
Synonyms
TMEFF1; TMEFF1 cDNA Clone; TMEFF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcgccgcagccgctgaggcgccgctccggctgcctgccgcgcctccgctcgccttctgctgctacacgtcggtgcttctgctcttcgccttctctctgccagggagccgcgcgtccaaccagcccccgggtggtggcggcggcagcggcggggactgtcccggcggcaaaggcaagagcatcaactgctcagaattaaatgtgagggagtctgacgtaagagtttgtgatgagtcatcatgtaaatatggaggagtctgtaaagaagatggagatggtttgaaatgtgcatgccaatttcagtgccatacaaattatattcctgtctgtggatcaaatggggacacttatcaaaatgaatgctttctcagaagggctgcttgtaagcaccagaaagagataacagtaatagcaagaggaccatgctactctgataatggatctggatctggagaaggagaagaggaagggtcaggggcagaagttcacagaaaacactccaagtgtggaccctgcaaatataaagctgagtgtgatgaagatgcagaaaatgttgggtgtgtatgtaatatagattgcagtggatacagttttaatcctgtgtgtgcttctgatgggagttcctataacaatccctgttttgttcgagaagcatcttgtataaagcaagaacaaattgatataaggcatcttggtcattgcacagatacagatgacactagtttgttgggaaagaaagatgatggactacaatatcgaccagatgtgaaagatgctagtgatcaaagagaagatgtttatattggaaaccacatgccttgccctgaaaacctcaatggttactgcatccatggaaaatgtgaattcatctattctactcagaaggcttcttgtagatgtgaatctggctacactggacagcactgtgaaaagacagactttagtattctctatgtagtgccaagtaggcaaaagctcactcatgttcttattgcagcaattattggagctgtacagattgccatcatagtagcaattgtaatgtgcataacaagaaaatgccccaaaaacaatagaggacgtcgacagaagcaaaacctaggtcattttacttcagatacgtcatccagaatggtttaa
Sequence Length
1143
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,757 Da
NCBI Official Full Name
Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1, mRNA
NCBI Official Synonym Full Names
transmembrane protein with EGF like and two follistatin like domains 1
NCBI Official Symbol
TMEFF1
NCBI Official Synonym Symbols
TR-1; H7365; C9orf2; CT120.1
NCBI Protein Information
tomoregulin-1
UniProt Protein Name
Tomoregulin-1
Protein Family
UniProt Gene Name
TMEFF1
UniProt Synonym Gene Names
C9orf2; TR-1
UniProt Entry Name
TEFF1_HUMAN

Uniprot Description

TMEFF1: a single-pass type I membrane protein. May inhibit NODAL and BMP signaling during neural patterning. A member of the Cancer-Testis Antigen (CTA) superfamily. CTAs may play roles in embryonal development and tumor transformation or aspects of tumor progression. CTAs were once thought to be silenced in most normal adult tissues, with limited expression in fetal, placental, testis, and ovarian cells. These proteins are now known to be aberrantly expressed in various cancers and many are capable of eliciting humoral and cellular immune responses. Expressed predominantly in brain, and at lower levels in heart, placenta and skeletal muscle. Down-regulated in brain tumors as compared to control brain tissues. Expressed in a variety of cancers cell lines and in myeloma cells. Belongs to the tomoregulin family. Two isoforms of the human protein are produced by alternative splicing. Note: This description may include information from RefSeq and UniProtKB

Protein type: Cancer Testis Antigen (CTA); Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q31

Research Articles on TMEFF1

Similar Products

Product Notes

The TMEFF1 tmeff1 (Catalog #AAA1274243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgccg cagccgctga ggcgccgctc cggctgcctg ccgcgcctcc gctcgccttc tgctgctaca cgtcggtgct tctgctcttc gccttctctc tgccagggag ccgcgcgtcc aaccagcccc cgggtggtgg cggcggcagc ggcggggact gtcccggcgg caaaggcaag agcatcaact gctcagaatt aaatgtgagg gagtctgacg taagagtttg tgatgagtca tcatgtaaat atggaggagt ctgtaaagaa gatggagatg gtttgaaatg tgcatgccaa tttcagtgcc atacaaatta tattcctgtc tgtggatcaa atggggacac ttatcaaaat gaatgctttc tcagaagggc tgcttgtaag caccagaaag agataacagt aatagcaaga ggaccatgct actctgataa tggatctgga tctggagaag gagaagagga agggtcaggg gcagaagttc acagaaaaca ctccaagtgt ggaccctgca aatataaagc tgagtgtgat gaagatgcag aaaatgttgg gtgtgtatgt aatatagatt gcagtggata cagttttaat cctgtgtgtg cttctgatgg gagttcctat aacaatccct gttttgttcg agaagcatct tgtataaagc aagaacaaat tgatataagg catcttggtc attgcacaga tacagatgac actagtttgt tgggaaagaa agatgatgga ctacaatatc gaccagatgt gaaagatgct agtgatcaaa gagaagatgt ttatattgga aaccacatgc cttgccctga aaacctcaat ggttactgca tccatggaaa atgtgaattc atctattcta ctcagaaggc ttcttgtaga tgtgaatctg gctacactgg acagcactgt gaaaagacag actttagtat tctctatgta gtgccaagta ggcaaaagct cactcatgtt cttattgcag caattattgg agctgtacag attgccatca tagtagcaat tgtaatgtgc ataacaagaa aatgccccaa aaacaataga ggacgtcgac agaagcaaaa cctaggtcat tttacttcag atacgtcatc cagaatggtt taa. It is sometimes possible for the material contained within the vial of "TMEFF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.