Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HEPACAM cdna clone

HEPACAM cDNA Clone

Gene Names
HEPACAM; MLC2A; MLC2B; GlialCAM
Synonyms
HEPACAM; HEPACAM cDNA Clone; HEPACAM cdna clone
Ordering
For Research Use Only!
Sequence
atgaagagagaaaggggagccctgtccagagcctccagggccctgcgccttgctccttttgtctaccttcttctgatccagacagaccccctggagggggtgaacatcaccagccccgtgcgcctgatccatggcaccgtggggaagtcggctctgctttctgtgcagtacagcagtaccagcagcgacaggcctgtagtgaagtggcagctgaagcgggacaagccagtgaccgtggtgcagtccattggcacagaggtcatcggcaccctgcggcctgactatcgagaccgtatccgactctttgaaaatggctccctgcttctcagcgacctgcagctggccgatgagggcacctatgaggtcgagatctccatcaccgacgacaccttcactggggagaagaccatcaaccttactgtagatgtgcccatttcgaggccacaggtgttggtggcttcaaccactgtgctggagctcagcgaggccttcaccttgaactgctcacatgagaatggcaccaagcccagctacacctggctgaaggatggcaagcccctcctcaatgactcgagaatgctcctgtcccccgaccaaaaggtgctcaccatcacccgcgtgctcatggaggatgacgacctgtacagctgcatggtggagaaccccatcagccagggccgcagcctgcctgtcaagatcaccgtatacagaagaagctccctttacatcatcttgtctacaggaggcatcttcctccttgtgaccttggtgacagtctgtgcctgctggaaaccctccaaaaggaaacagaagaagctagaaaagcaaaactccctggaatacatggatcagaatgatgaccgcctgaaaccagaagcagacaccctccctcgaagtggtgagcaggaacggaagaaccccatggcactctatatcctgaaggacaaggactccccggagaccgaggagaacccggccccggagcctcgaagcgcgacggagcccggcccgcccggctactccgtgtctcccgccgtgcccggccgctcgccggggctgcccatccgctctgcccgccgctacccgcgctccccagcgcgctccccagccaccggccggacacactcgtcgccgcccagggccccgagctcgcccggccgctcgcgcagcgcctcgcgcacactgcggactgcgggcgtgcacataatccgcgagcaagacgaggccggcccggtggagatcagcgcctga
Sequence Length
1251
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,564 Da
NCBI Official Full Name
Homo sapiens hepatocyte cell adhesion molecule, mRNA
NCBI Official Synonym Full Names
hepatic and glial cell adhesion molecule
NCBI Official Symbol
HEPACAM
NCBI Official Synonym Symbols
MLC2A; MLC2B; GlialCAM
NCBI Protein Information
hepatocyte cell adhesion molecule
UniProt Protein Name
Hepatocyte cell adhesion molecule
Protein Family
UniProt Gene Name
HEPACAM
UniProt Synonym Gene Names
Protein hepaCAM
UniProt Entry Name
HECAM_HUMAN

NCBI Description

The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]

Uniprot Description

HEPACAM: Involved in regulating cell motility and cell-matrix interactions. May inhibit cell growth through suppression of cell proliferation. Defects in HEPACAM are the cause of leukoencephalopathy megalencephalic with subcortical cysts type 2A (MLC2A). MLC2A is a neurodegenerative disorder characterized by infantile-onset macrocephaly and later onset of motor deterioration, with ataxia and spasticity, seizures, and cognitive decline of variable severity. The brain appears swollen on magnetic resonance imaging with white-matter abnormalities and subcortical cysts, in all stages of the disease. Defects in HEPACAM are the cause of leukoencephalopathy megalencephalic with subcortical cysts type 2B (MLC2B). MLC2B is a neurodegenerative disorder characterized by infantile-onset of macrocephaly and mildly delayed motor development associated with white-matter abnormalities on brain magnetic resonance imaging. The phenotype is milder that MLC2A, with better preserved cerebellar white matter and no subcortical cysts outside the temporal region. On follow-up, patients show normal or almost normal motor function. Some patients have normal intelligence, whereas others have a significant cognitive deficiency. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: axon; intercellular junction

Disease: Megalencephalic Leukoencephalopathy With Subcortical Cysts 1; Megalencephalic Leukoencephalopathy With Subcortical Cysts 2a; Megalencephalic Leukoencephalopathy With Subcortical Cysts 2b, Remitting, With Or Without Mental Retardation

Research Articles on HEPACAM

Similar Products

Product Notes

The HEPACAM hepacam (Catalog #AAA1274178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagagag aaaggggagc cctgtccaga gcctccaggg ccctgcgcct tgctcctttt gtctaccttc ttctgatcca gacagacccc ctggaggggg tgaacatcac cagccccgtg cgcctgatcc atggcaccgt ggggaagtcg gctctgcttt ctgtgcagta cagcagtacc agcagcgaca ggcctgtagt gaagtggcag ctgaagcggg acaagccagt gaccgtggtg cagtccattg gcacagaggt catcggcacc ctgcggcctg actatcgaga ccgtatccga ctctttgaaa atggctccct gcttctcagc gacctgcagc tggccgatga gggcacctat gaggtcgaga tctccatcac cgacgacacc ttcactgggg agaagaccat caaccttact gtagatgtgc ccatttcgag gccacaggtg ttggtggctt caaccactgt gctggagctc agcgaggcct tcaccttgaa ctgctcacat gagaatggca ccaagcccag ctacacctgg ctgaaggatg gcaagcccct cctcaatgac tcgagaatgc tcctgtcccc cgaccaaaag gtgctcacca tcacccgcgt gctcatggag gatgacgacc tgtacagctg catggtggag aaccccatca gccagggccg cagcctgcct gtcaagatca ccgtatacag aagaagctcc ctttacatca tcttgtctac aggaggcatc ttcctccttg tgaccttggt gacagtctgt gcctgctgga aaccctccaa aaggaaacag aagaagctag aaaagcaaaa ctccctggaa tacatggatc agaatgatga ccgcctgaaa ccagaagcag acaccctccc tcgaagtggt gagcaggaac ggaagaaccc catggcactc tatatcctga aggacaagga ctccccggag accgaggaga acccggcccc ggagcctcga agcgcgacgg agcccggccc gcccggctac tccgtgtctc ccgccgtgcc cggccgctcg ccggggctgc ccatccgctc tgcccgccgc tacccgcgct ccccagcgcg ctccccagcc accggccgga cacactcgtc gccgcccagg gccccgagct cgcccggccg ctcgcgcagc gcctcgcgca cactgcggac tgcgggcgtg cacataatcc gcgagcaaga cgaggccggc ccggtggaga tcagcgcctg a. It is sometimes possible for the material contained within the vial of "HEPACAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.