Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DGKA cdna clone

DGKA cDNA Clone

Gene Names
DGKA; DAGK; DAGK1; DGK-alpha
Synonyms
DGKA; DGKA cDNA Clone; DGKA cdna clone
Ordering
For Research Use Only!
Sequence
atggccaaggagaggggcctaataagccccagtgattttgcccagctgcaaaaatacatggaatactccaccaaaaaggtcagtgatgtcctaaagctcttcgaggatggcgagatggctaaatatgtccaaggagatgccattgggtacgagggattccagcaattcctgaaaatctatctcgaagtggataatgttcccagacacctaagcctggcactgtttcaatcctttgagactggtcactgcttaaatgagacaaatgtgacaaaagatgtggtgtgtctcaatgatgtttcctgctacttttcccttctggagggtggtcggccagaagacaagttagaattcaccttcaagctgtacgacacggacagaaatgggatcctggacagctcagaagtggacaaaattatcctacagatgatgcgagtggctgaatacctggattgggatgtgtctgagctgaggccgattcttcaggagatgatgaaagagattgactatgatggcagtggctctgtctctcaagctgagtgggtccgggctggggccaccaccgtgccactgctagtgctgctgggtctggagatgactctgaaggacgacggacagcacatgtggaggcccaagaggttccccagaccagtctactgcaatctgtgcgagtcaagcattggtcttggcaaacagggactgagctgtaacctctgtaagtacactgttcacgaccagtgtgccatgaaagccctgccttgtgaagtcagcacctatgccaagtctcggaaggacattggtgtccaatcacatgtgtgggtgcgaggaggctgtgagtccgggcgctgcgaccgctgtcagaaaaagatccggatctaccacagtctgaccgggctgcattgtgtatggtgccacctagagatccacgatgactgcctgcaagcggtgggccatgagtgtgactgtgggctgctccgggatcacatcctgcctccatcttccatctatcccagtgtcctggcctctggaccggatcgtaaaaatagcaaaacaagccagaagaccatggatgatttaaatttgagcacctctgaggctctgcggattgaccctgttcctaacacccacccacttctcgtctttgtcaatcctaagagtggcgggaagcaggggcaaagggtgctctggaagttccagtatatattaaaccctcgacaggtgttcaacctcctaaaggatggtcctgagatagggctccgattattcaaggatgttcctgatagccggattttggtgtgtggtggagacggcacagtaggctggattctagagaccattgacaaagctaacttgccagttttgcctcctgttgctgtgttgcccctgggtactggaaatgatctggctcgatgcctaagatggggaggaggttatgaaggacagaatctggcaaagatcctcaaggatttagagatgagtaaagtggtacatatggatcgatggtctgtggaggtgatacctcaacaaactgaagaaaaaagtgacccagtcccctttcaaatcatcaataactacttctctattggcgtggatgcctctattgctcatcgattctacatcatgcgagagaaatatccggagaagttcaacagcagaatgaagaacaagctatggtacttcgaatttgccacatctgaatccatcttctcaacatgcaaaaagctggaggagtctttgacagttgagatctgtgggaaaccgctggatctgagcaacctgtccctagaaggcatcgcagtgctaaacatccctagcatgcatggtggctccaacctctggggtgataccaggagaccccatggggatatctatgggatcaaccaggccttaggtgctacagctaaagtcatcaccgaccctgatatcctgaaaacctgtgtaccagacctaagtgacaagagactggaagtggttgggctggagggtgcaattgagatgggccaaatctataccaagctcaagaatgctggacgtcggctggccaagtgctctgagatcaccttccacaccacaaaaacccttcccatgcaaattgacggagaaccctggatgcagacgccctgtacaatcaagatcacccacaagaaccagatgcccatgctcatgggcccacccccccgctccaccaatttctttggcttcttgagctaa
Sequence Length
2208
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,094 Da
NCBI Official Full Name
Homo sapiens diacylglycerol kinase, alpha 80kDa, mRNA
NCBI Official Synonym Full Names
diacylglycerol kinase alpha
NCBI Official Symbol
DGKA
NCBI Official Synonym Symbols
DAGK; DAGK1; DGK-alpha
NCBI Protein Information
diacylglycerol kinase alpha
UniProt Protein Name
Diacylglycerol kinase alpha
Protein Family
UniProt Gene Name
DGKA
UniProt Synonym Gene Names
DAGK; DAGK1; DAG kinase alpha; DGK-alpha
UniProt Entry Name
DGKA_HUMAN

NCBI Description

The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

DGKA: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity. Monomer. Lymphocytes and oligodendroglial cells. Stimulated by calcium and phosphatidylserine. Phosphorylated by protein kinase C. Belongs to the eukaryotic diacylglycerol kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; EC 2.7.1.107; Kinase, lipid; Lipid Metabolism - glycerophospholipid; Lipid Metabolism - glycerolipid

Chromosomal Location of Human Ortholog: 12q13.3

Cellular Component: membrane; plasma membrane

Molecular Function: diacylglycerol kinase activity

Biological Process: phosphatidic acid biosynthetic process; platelet activation

Research Articles on DGKA

Similar Products

Product Notes

The DGKA dgka (Catalog #AAA1274145) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaagg agaggggcct aataagcccc agtgattttg cccagctgca aaaatacatg gaatactcca ccaaaaaggt cagtgatgtc ctaaagctct tcgaggatgg cgagatggct aaatatgtcc aaggagatgc cattgggtac gagggattcc agcaattcct gaaaatctat ctcgaagtgg ataatgttcc cagacaccta agcctggcac tgtttcaatc ctttgagact ggtcactgct taaatgagac aaatgtgaca aaagatgtgg tgtgtctcaa tgatgtttcc tgctactttt cccttctgga gggtggtcgg ccagaagaca agttagaatt caccttcaag ctgtacgaca cggacagaaa tgggatcctg gacagctcag aagtggacaa aattatccta cagatgatgc gagtggctga atacctggat tgggatgtgt ctgagctgag gccgattctt caggagatga tgaaagagat tgactatgat ggcagtggct ctgtctctca agctgagtgg gtccgggctg gggccaccac cgtgccactg ctagtgctgc tgggtctgga gatgactctg aaggacgacg gacagcacat gtggaggccc aagaggttcc ccagaccagt ctactgcaat ctgtgcgagt caagcattgg tcttggcaaa cagggactga gctgtaacct ctgtaagtac actgttcacg accagtgtgc catgaaagcc ctgccttgtg aagtcagcac ctatgccaag tctcggaagg acattggtgt ccaatcacat gtgtgggtgc gaggaggctg tgagtccggg cgctgcgacc gctgtcagaa aaagatccgg atctaccaca gtctgaccgg gctgcattgt gtatggtgcc acctagagat ccacgatgac tgcctgcaag cggtgggcca tgagtgtgac tgtgggctgc tccgggatca catcctgcct ccatcttcca tctatcccag tgtcctggcc tctggaccgg atcgtaaaaa tagcaaaaca agccagaaga ccatggatga tttaaatttg agcacctctg aggctctgcg gattgaccct gttcctaaca cccacccact tctcgtcttt gtcaatccta agagtggcgg gaagcagggg caaagggtgc tctggaagtt ccagtatata ttaaaccctc gacaggtgtt caacctccta aaggatggtc ctgagatagg gctccgatta ttcaaggatg ttcctgatag ccggattttg gtgtgtggtg gagacggcac agtaggctgg attctagaga ccattgacaa agctaacttg ccagttttgc ctcctgttgc tgtgttgccc ctgggtactg gaaatgatct ggctcgatgc ctaagatggg gaggaggtta tgaaggacag aatctggcaa agatcctcaa ggatttagag atgagtaaag tggtacatat ggatcgatgg tctgtggagg tgatacctca acaaactgaa gaaaaaagtg acccagtccc ctttcaaatc atcaataact acttctctat tggcgtggat gcctctattg ctcatcgatt ctacatcatg cgagagaaat atccggagaa gttcaacagc agaatgaaga acaagctatg gtacttcgaa tttgccacat ctgaatccat cttctcaaca tgcaaaaagc tggaggagtc tttgacagtt gagatctgtg ggaaaccgct ggatctgagc aacctgtccc tagaaggcat cgcagtgcta aacatcccta gcatgcatgg tggctccaac ctctggggtg ataccaggag accccatggg gatatctatg ggatcaacca ggccttaggt gctacagcta aagtcatcac cgaccctgat atcctgaaaa cctgtgtacc agacctaagt gacaagagac tggaagtggt tgggctggag ggtgcaattg agatgggcca aatctatacc aagctcaaga atgctggacg tcggctggcc aagtgctctg agatcacctt ccacaccaca aaaacccttc ccatgcaaat tgacggagaa ccctggatgc agacgccctg tacaatcaag atcacccaca agaaccagat gcccatgctc atgggcccac ccccccgctc caccaatttc tttggcttct tgagctaa. It is sometimes possible for the material contained within the vial of "DGKA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.