CNBP cdna clone

CNBP cDNA Clone

Gene Names

CNBP; DM2; ZNF9; CNBP1; PROMM; RNF163; ZCCHC22

Synonyms

CNBP; CNBP cDNA Clone; CNBP cdna clone

Ordering
Cat. Num. AAA1274119 When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures. For Research Use Only!

Sequence

atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagatatttgttatcgctgtggtgagtctggtcatcttgccaaggattgtgatcttcaggaggatgcctgctataactgcggtagaggtggccacattgccaaggactgcaaggagcccaagagagagcgagagcaatgctgctacaactgtggcaaaccaggccatctggctcgtgactgcgaccatgcagatgagcagaaatgctattcttgtggagaattcggacacattcaaaaagactgcaccaaagtgaagtgctataggtgtggtgaaactggtcatgtagccatcaactgcagcaagacaagtgaagtcaactgttaccgctgtggcgagtcagggcaccttgcacgggaatgcacaattgaggctacagcctaa

Sequence Length

513

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33875259

NCBI GeneID

7555

Molecular Weight

18,871 Da

NCBI Official Full Name

Homo sapiens CCHC-type zinc finger, nucleic acid binding protein, mRNA

NCBI Official Synonym Full Names

CCHC-type zinc finger nucleic acid binding protein

NCBI Official Symbol

CNBP

NCBI Official Synonym Symbols

DM2; ZNF9; CNBP1; PROMM; RNF163; ZCCHC22

NCBI Protein Information

cellular nucleic acid-binding protein

UniProt Protein Name

Cellular nucleic acid-binding protein

Protein Family

Cellular nucleic acid-binding protein

UniProt Gene Name

CNBP

UniProt Synonym Gene Names

RNF163; ZNF9; CNBP

UniProt Entry Name

CNBP_HUMAN

NCBI Description

This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

Uniprot Description

ZNF9: Single stranded DNA-binding protein, with specificity to the sterol regulatory element (SRE). Involved in sterol-mediated repression. Defects in CNBP are the cause of dystrophia myotonica type 2 (DM2); also known as proximal myotonic myopathy (PROMM). A multisystem disease characterized by the association of proximal muscle weakness with myotonia, cardiac manifestations and cataract. Additional features can include hyperhidrosis, testicular atrophy, insulin resistance and diabetes and central nervous system anomalies in rare cases. The causative mutation is a CCTG expansion (mean approximately 5000 repeats) located in intron 1 of the CNBP gene. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 3q21

Cellular Component: cytosol; endoplasmic reticulum; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: cholesterol biosynthetic process; positive regulation of cell proliferation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent

Disease: Myotonic Dystrophy 2

Research Articles on CNBP

1. High CNBP expression is associated with Medulloblastoma.

Similar Products

Product Notes

The CNBP cnbp (Catalog #AAA1274119) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcagca atgagtgctt caagtgtgga cgatctggcc actgggcccg ggaatgtcct actggtggag gccgtggtcg tggaatgaga agccgtggca gaggtttcca gtttgtttcc tcgtctcttc cagatatttg ttatcgctgt ggtgagtctg gtcatcttgc caaggattgt gatcttcagg aggatgcctg ctataactgc ggtagaggtg gccacattgc caaggactgc aaggagccca agagagagcg agagcaatgc tgctacaact gtggcaaacc aggccatctg gctcgtgact gcgaccatgc agatgagcag aaatgctatt cttgtggaga attcggacac attcaaaaag actgcaccaa agtgaagtgc tataggtgtg gtgaaactgg tcatgtagcc atcaactgca gcaagacaag tgaagtcaac tgttaccgct gtggcgagtc agggcacctt gcacgggaat gcacaattga ggctacagcc taa. It is sometimes possible for the material contained within the vial of "CNBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...