Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MBD4 cdna clone

MBD4 cDNA Clone

Gene Names
MBD4; MED1
Synonyms
MBD4; MBD4 cDNA Clone; MBD4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcacgactgggctggagagtctgagtctgggggaccgcggagctgcccccaccgtcacctctagtgagcgcctagtcccagacccgccgaatgacctccgcaaagaagatgttgctatggaattggaaagagtgggagaagatgaggaacaaatgatgataaaaagaagcagtgaatgtaatcccttgctacaagaacccatcgcttctgctcagtttggtgctactgcaggaacagaatgccgtaagtctgtcccatgtggatgggaaagagttgtgaagcaaaggttatttgggaagacagcaggaagatttgatgtgtactttatcagcccacaaggactgaagttcagatccaaaagttcacttgctaattatcttcacaaaaatggagagacttctcttaagccagaagattttgattttactgtactttctaaaaggggtatcaagtcaagatataaagactgcagcatggcagccctgacatcccatctacaaaaccaaagtaacaattcaaactggaacctcaggacccgaagcaagtgcaaaaaggatgtgtttatgccgccaagtagtagttcagagttgcaggagagcagaggactctctaactttacttccactcatttgcttttgaaagaagatgagggtgttgatgatgttaacttcagaaaggttagaaagcccaaaggaaaggtgactattttgaaaggaatcccaattaagaaaactaaaaaaggatgtaggaagagctgttcaggttttgttcaaagtgatagcaaaagagaatctgtgtgtaataaagcagatgctgaaagtgaacctgttgcacaaaaaagtcagcttgatagaactgtctgcatttctgatgctggagcatgtggtgagaccctcagtgtgaccagtgaagaaaacagccttgtaaaaaaaaaagaaagatcattgagttcaggatcaaatttttgttctgaacaaaaaacttctggcatcataaacaaattttgttcagccaaagactcagaacacaacgagaagtatgaggatacctttttagaatctgaagaaatcggaacaaaagtagaagttgtggaaaggaaagaacatttgcatactgacattttaaaacgtggctctgaaatggacaacaactgctcaccaaccaggaaagacttcactgaagataccatcccacgaacacagatagaaagaaggaaaacaagcctgtatttttccagcaaatataacaaagaagctcttagccccccacgacgtaaagcctttaagaaatggacacctcctcggtcaccttttaatctcgttcaagaaacactttttcatgatccatggaagcttctcatcgctactatatttctcaatcggacctcaggcaaaatggcaatacctgtgctttggaagtttctggagaagtatccttcagctgaggtagcaagaaccgcagactggagagatgtgtcagaacttcttaaacctcttggtctctacgatcttcgggcaaaaaccattgtcaagttctcagatgaatacctgacaaagcagtggaagtatccaattgagcttcatgggattggtaaatatggcaacgactcttaccgaattttttgtgtcaatgagtggaagcaggtgcaccctgaagaccacaaattaaataaatatcatgactggctttgggaaaatcatgaaaaattaagtctatcttaa
Sequence Length
1725
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,316 Da
NCBI Official Full Name
Homo sapiens methyl-CpG binding domain protein 4, mRNA
NCBI Official Synonym Full Names
methyl-CpG binding domain 4, DNA glycosylase
NCBI Official Symbol
MBD4
NCBI Official Synonym Symbols
MED1
NCBI Protein Information
methyl-CpG-binding domain protein 4
UniProt Protein Name
Methyl-CpG-binding domain protein 4
UniProt Gene Name
MBD4
UniProt Synonym Gene Names
MED1
UniProt Entry Name
MBD4_HUMAN

NCBI Description

The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]

Uniprot Description

MBD4: Mismatch-specific DNA N-glycosylase involved in DNA repair. Has thymine glycosylase activity and is specific for G:T mismatches within methylated and unmethylated CpG sites. Can also remove uracil or 5-fluorouracil in G:U mismatches. Has no lyase activity. Was first identified as methyl-CpG-binding protein. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; EC 3.2.2.-; Deoxyribonuclease; DNA repair, damage

Chromosomal Location of Human Ortholog: 3q21.3

Cellular Component: chromatin; nucleoplasm; nucleus

Molecular Function: DNA N-glycosylase activity; endodeoxyribonuclease activity; protein binding; pyrimidine-specific mismatch base pair DNA N-glycosylase activity; satellite DNA binding

Biological Process: depyrimidination; DNA repair; response to radiation

Research Articles on MBD4

Similar Products

Product Notes

The MBD4 mbd4 (Catalog #AAA1274092) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcacga ctgggctgga gagtctgagt ctgggggacc gcggagctgc ccccaccgtc acctctagtg agcgcctagt cccagacccg ccgaatgacc tccgcaaaga agatgttgct atggaattgg aaagagtggg agaagatgag gaacaaatga tgataaaaag aagcagtgaa tgtaatccct tgctacaaga acccatcgct tctgctcagt ttggtgctac tgcaggaaca gaatgccgta agtctgtccc atgtggatgg gaaagagttg tgaagcaaag gttatttggg aagacagcag gaagatttga tgtgtacttt atcagcccac aaggactgaa gttcagatcc aaaagttcac ttgctaatta tcttcacaaa aatggagaga cttctcttaa gccagaagat tttgatttta ctgtactttc taaaaggggt atcaagtcaa gatataaaga ctgcagcatg gcagccctga catcccatct acaaaaccaa agtaacaatt caaactggaa cctcaggacc cgaagcaagt gcaaaaagga tgtgtttatg ccgccaagta gtagttcaga gttgcaggag agcagaggac tctctaactt tacttccact catttgcttt tgaaagaaga tgagggtgtt gatgatgtta acttcagaaa ggttagaaag cccaaaggaa aggtgactat tttgaaagga atcccaatta agaaaactaa aaaaggatgt aggaagagct gttcaggttt tgttcaaagt gatagcaaaa gagaatctgt gtgtaataaa gcagatgctg aaagtgaacc tgttgcacaa aaaagtcagc ttgatagaac tgtctgcatt tctgatgctg gagcatgtgg tgagaccctc agtgtgacca gtgaagaaaa cagccttgta aaaaaaaaag aaagatcatt gagttcagga tcaaattttt gttctgaaca aaaaacttct ggcatcataa acaaattttg ttcagccaaa gactcagaac acaacgagaa gtatgaggat acctttttag aatctgaaga aatcggaaca aaagtagaag ttgtggaaag gaaagaacat ttgcatactg acattttaaa acgtggctct gaaatggaca acaactgctc accaaccagg aaagacttca ctgaagatac catcccacga acacagatag aaagaaggaa aacaagcctg tatttttcca gcaaatataa caaagaagct cttagccccc cacgacgtaa agcctttaag aaatggacac ctcctcggtc accttttaat ctcgttcaag aaacactttt tcatgatcca tggaagcttc tcatcgctac tatatttctc aatcggacct caggcaaaat ggcaatacct gtgctttgga agtttctgga gaagtatcct tcagctgagg tagcaagaac cgcagactgg agagatgtgt cagaacttct taaacctctt ggtctctacg atcttcgggc aaaaaccatt gtcaagttct cagatgaata cctgacaaag cagtggaagt atccaattga gcttcatggg attggtaaat atggcaacga ctcttaccga attttttgtg tcaatgagtg gaagcaggtg caccctgaag accacaaatt aaataaatat catgactggc tttgggaaaa tcatgaaaaa ttaagtctat cttaa. It is sometimes possible for the material contained within the vial of "MBD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.