LAPTM4B cdna clone
LAPTM4B cDNA Clone
Gene Names
LAPTM4B; LC27; LAPTM4beta
Synonyms
LAPTM4B; LAPTM4B cDNA Clone; LAPTM4B cdna clone
Sequence
atgaagatggtcgcgccctggacgcggttctactccaacagctgctgcttgtgctgccatgtccgcaccggcaccatcctgctcggcgtctggtatctgatcatcaatgctgtggtactgttgattttattgagtgccctggctgatccggatcagtataacttttcaagttctgaactgggaggtgactttgagttcatggatgatgccaacatgtgcattgccattgcgatttctcttctcatgatcctgatatgtgctatggctacttacggagcgtacaagcaacgcgcagcctggatcatcccattcttctgttaccagatctttgactttgccctgaacatgttggttgcaatcactgtgcttatttatccaaactccattcaggaatacatacggcaactgcctcctaattttccctacagagatgatgtcatgtcagtgaatcctacctgtttggtccttattattcttctgtttattagcattatcttgacttttaagggttacttgattagctgtgtttggaactgctaccgatacatcaatggtaggaactcctctgatgtcctggtttatgttaccagcaatgacactacggtgctgctacccccgtatgatgatgccactgtgaatggtgctgccaaggagccaccgccaccttacgtgtctgcctaa
Sequence Length
681
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,123 Da
NCBI Official Full Name
Homo sapiens lysosomal protein transmembrane 4 beta, mRNA
NCBI Official Synonym Full Names
lysosomal protein transmembrane 4 beta
NCBI Official Symbol
LAPTM4B
NCBI Official Synonym Symbols
LC27; LAPTM4beta
NCBI Protein Information
lysosomal-associated transmembrane protein 4B
UniProt Protein Name
Lysosomal-associated transmembrane protein 4B
Protein Family
UniProt Gene Name
LAPTM4B
UniProt Entry Name
LAP4B_HUMAN
Uniprot Description
LAPTM4B: Belongs to the LAPTM4/LAPTM5 transporter family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Transporter; Membrane protein, integral
Chromosomal Location of Human Ortholog: 8q22.1
Cellular Component: membrane
Molecular Function: protein binding
Research Articles on LAPTM4B
Similar Products
Product Notes
The LAPTM4B laptm4b (Catalog #AAA1274088) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatgg tcgcgccctg gacgcggttc tactccaaca gctgctgctt gtgctgccat gtccgcaccg gcaccatcct gctcggcgtc tggtatctga tcatcaatgc tgtggtactg ttgattttat tgagtgccct ggctgatccg gatcagtata acttttcaag ttctgaactg ggaggtgact ttgagttcat ggatgatgcc aacatgtgca ttgccattgc gatttctctt ctcatgatcc tgatatgtgc tatggctact tacggagcgt acaagcaacg cgcagcctgg atcatcccat tcttctgtta ccagatcttt gactttgccc tgaacatgtt ggttgcaatc actgtgctta tttatccaaa ctccattcag gaatacatac ggcaactgcc tcctaatttt ccctacagag atgatgtcat gtcagtgaat cctacctgtt tggtccttat tattcttctg tttattagca ttatcttgac ttttaagggt tacttgatta gctgtgtttg gaactgctac cgatacatca atggtaggaa ctcctctgat gtcctggttt atgttaccag caatgacact acggtgctgc tacccccgta tgatgatgcc actgtgaatg gtgctgccaa ggagccaccg ccaccttacg tgtctgccta a. It is sometimes possible for the material contained within the vial of "LAPTM4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
