Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GUCA1A cdna clone

GUCA1A cDNA Clone

Gene Names
GUCA1A; COD3; GCAP; GUCA; GCAP1; GUCA1; CORD14; C6orf131
Synonyms
GUCA1A; GUCA1A cDNA Clone; GUCA1A cdna clone
Ordering
For Research Use Only!
Sequence
atgggcaacgtgatggagggaaagtcagtggaggagctgagcagcaccgagtgccaccagtggtacaagaagttcatgactgagtgcccctctggccaactcaccctctatgagttccgccagttcttcggcctcaagaacctgagcccgtcggccagccagtacgtggaacagatgtttgagacttttgacttcaacaaggacggctacattgatttcatggagtacgtggcagcgctcagcttggtcctcaaggggaaggtggaacagaagctccgctggtacttcaagctctatgatgtagatggcaacggctgcattgaccgcgatgagctgctcaccatcatccaggccattcgcgccattaacccctgcagcgataccaccatgactgcagaggagttcaccgatacagtgttctccaagattgacgtcaacggggatggggaactctccctggaagagtttatagagggcgtccagaaggaccagatgctcctggacacactgacacgaagcctggaccttacccgcatcgtgcgcaggctccagaatggcgagcaagacgaggagggggctgacgaggccgctgaggcagccggctga
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,920 Da
NCBI Official Full Name
Homo sapiens guanylate cyclase activator 1A (retina), mRNA
NCBI Official Synonym Full Names
guanylate cyclase activator 1A
NCBI Official Symbol
GUCA1A
NCBI Official Synonym Symbols
COD3; GCAP; GUCA; GCAP1; GUCA1; CORD14; C6orf131
NCBI Protein Information
guanylyl cyclase-activating protein 1
UniProt Protein Name
Guanylyl cyclase-activating protein 1
UniProt Gene Name
GUCA1A
UniProt Synonym Gene Names
C6orf131; GCAP; GCAP1; GUCA1; GCAP 1
UniProt Entry Name
GUC1A_HUMAN

NCBI Description

This gene encodes an enzyme that plays a role in the recovery of retinal photoreceptors from photobleaching. This enzyme promotes the activity of retinal guanylyl cyclase-1 (GC1) at low calcium concentrations and inhibits GC1 at high calcium concentrations. Mutations in this gene can cause cone dystrophy 3 and code-rod dystrophy 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

GUCA1A: Stimulates guanylyl cyclase 1 (GC1) when free calcium ions concentration is low and inhibits GC1 when free calcium ions concentration is elevated. This Ca(2+)-sensitive regulation of GC is a key event in recovery of the dark state of rod photoreceptors following light exposure. Defects in GUCA1A are the cause of cone dystrophy type 3 (COD3). COD3 is an autosomal dominant cone dystrophy. Cone dystrophies are retinal dystrophies characterized by progressive degeneration of the cone photoreceptors with preservation of rod function, as indicated by electroretinogram. However, some rod involvement may be present in some cone dystrophies, particularly at late stage. Affected individuals suffer from photophobia, loss of visual acuity, color vision and central visual field. Another sign is the absence of macular lesions for many years. Cone dystrophies are distinguished from the cone-rod dystrophies, in which some loss of peripheral vision also occurs.

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: plasma membrane

Molecular Function: calcium ion binding; calcium sensitive guanylate cyclase activator activity; guanylate cyclase regulator activity

Biological Process: positive regulation of guanylate cyclase activity; regulation of rhodopsin mediated signaling

Disease: Cone Dystrophy 3

Research Articles on GUCA1A

Similar Products

Product Notes

The GUCA1A guca1a (Catalog #AAA1274087) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaacg tgatggaggg aaagtcagtg gaggagctga gcagcaccga gtgccaccag tggtacaaga agttcatgac tgagtgcccc tctggccaac tcaccctcta tgagttccgc cagttcttcg gcctcaagaa cctgagcccg tcggccagcc agtacgtgga acagatgttt gagacttttg acttcaacaa ggacggctac attgatttca tggagtacgt ggcagcgctc agcttggtcc tcaaggggaa ggtggaacag aagctccgct ggtacttcaa gctctatgat gtagatggca acggctgcat tgaccgcgat gagctgctca ccatcatcca ggccattcgc gccattaacc cctgcagcga taccaccatg actgcagagg agttcaccga tacagtgttc tccaagattg acgtcaacgg ggatggggaa ctctccctgg aagagtttat agagggcgtc cagaaggacc agatgctcct ggacacactg acacgaagcc tggaccttac ccgcatcgtg cgcaggctcc agaatggcga gcaagacgag gagggggctg acgaggccgc tgaggcagcc ggctga. It is sometimes possible for the material contained within the vial of "GUCA1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.