Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPER cdna clone

GPER cDNA Clone

Gene Names
GPER1; mER; CEPR; GPER; DRY12; FEG-1; GPR30; LERGU; LyGPR; CMKRL2; LERGU2; GPCR-Br
Synonyms
GPER; GPER cDNA Clone; GPER cdna clone
Ordering
For Research Use Only!
Sequence
atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcctgttcctctcgtgcctctacaccatcttcctcttccccatcggctttgtgggcaacatcctgatcctggtggtgaacatcagcttccgcgagaagatgaccatccccgacctgtacttcatcaacctggcggtggcggacctcatcctggtggccgactccctcattgaggtgttcaacctgcacgagcggtactacgacatcgccgtcctgtgcaccttcatgtcgctcttcctgcaggtcaacatgtacagcagcgtcttcttcctcacctggatgagcttcgaccgctacatcgccctggccagggccatgcgctgcagcctgttccgcaccaagcaccacgcccggctgagctgtggcctcatctggatggcatccgtgtcagccacgctggtgcccttcaccgccgtgcacctgcagcacaccgacgaggcctgcttctgtttcgcggatgtccgggaggtgcagtggctcgaggtcacgctgggcttcatcgtgcccttcgccatcatcggcctgtgctactccctcattgtccgggtgctggtcagggcgcaccggcaccgtgggctgcggccccggcggcagaaggcgctccgcatgatcctcgcggtggtgctggtcttcttcgtctgctggctgccggagaacgtcttcatcagcgtgcacctcctgcagcggacgcagcctggggccgctccctgcaagcagtctttccgccatgcccaccccctcacgggccacattgtcaacctcgccgccttctccaacagctgcctaaaccccctcatctacagctttctcggggagaccttcagggacaagctgaggctgtacattgagcagaaaacaaatttgccggccctgaaccgcttctgtcacgctgccctgaaggccgtcattccagacagcactgagcagtcggatgtgaggttcagcagtgccgtgtag
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,248 Da
NCBI Official Full Name
Homo sapiens G protein-coupled estrogen receptor 1, mRNA
NCBI Official Synonym Full Names
G protein-coupled estrogen receptor 1
NCBI Official Symbol
GPER1
NCBI Official Synonym Symbols
mER; CEPR; GPER; DRY12; FEG-1; GPR30; LERGU; LyGPR; CMKRL2; LERGU2; GPCR-Br
NCBI Protein Information
G-protein coupled estrogen receptor 1
UniProt Protein Name
G-protein coupled estrogen receptor 1
UniProt Gene Name
GPER1
UniProt Synonym Gene Names
CEPR; CMKRL2; DRY12; GPER; GPR30; FEG-1; LYGPR; mER
UniProt Entry Name
GPER1_HUMAN

NCBI Description

This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

GPER1: Receptor for estrogen. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis; Membrane protein, multi-pass; GPCR, family 1; Receptor, GPCR

Chromosomal Location of Human Ortholog: 7p22.3

Cellular Component: axon; cytoplasm; cytoplasmic vesicle membrane; dendrite; dendritic shaft; early endosome; endoplasmic reticulum; Golgi apparatus; integral to plasma membrane; intracellular; keratin filament; mitochondrial membrane; nerve terminal; nuclear envelope; nucleus; perinuclear region of cytoplasm; plasma membrane; postsynaptic density; presynaptic active zone; presynaptic membrane; recycling endosome; trans-Golgi network

Molecular Function: chromatin binding; estrogen receptor activity; mineralocorticoid receptor activity; protein binding; steroid binding

Biological Process: apoptotic chromosome condensation; cytosolic calcium ion homeostasis; elevation of cytosolic calcium ion concentration; G-protein coupled receptor protein signaling pathway; generation of action potential; negative regulation of cell proliferation; negative regulation of DNA metabolic process; negative regulation of fat cell differentiation; negative regulation of inflammatory response; negative regulation of leukocyte activation; negative regulation of lipid biosynthetic process; negative regulation of protein kinase B signaling cascade; nuclear fragmentation during apoptosis; positive regulation of apoptosis; positive regulation of cAMP biosynthetic process; positive regulation of caspase activity; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of epidermal growth factor receptor signaling pathway; positive regulation of G-protein coupled receptor protein signaling pathway; positive regulation of inositol trisphosphate biosynthetic process; positive regulation of insulin secretion; positive regulation of MAPKKK cascade; positive regulation of neurogenesis; positive regulation of neurotransmitter secretion; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid phosphorylation; positive regulation of release of sequestered calcium ion into cytosol; positive regulation of transcription from RNA polymerase II promoter; positive regulation of vasodilation; steroid hormone mediated signaling; steroid hormone receptor signaling pathway

Research Articles on GPER

Similar Products

Product Notes

The GPER gper1 (Catalog #AAA1273905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgtga cttcccaagc ccggggcgtg ggcctggaga tgtacctagg caccgcgcag cctgcggccc ccaacaccac ctcccccgag ctcaacctgt cccacccgct cctgggcacc gccctggcca atgggacagg tgagctctcg gagcaccagc agtacgtgat cggcctgttc ctctcgtgcc tctacaccat cttcctcttc cccatcggct ttgtgggcaa catcctgatc ctggtggtga acatcagctt ccgcgagaag atgaccatcc ccgacctgta cttcatcaac ctggcggtgg cggacctcat cctggtggcc gactccctca ttgaggtgtt caacctgcac gagcggtact acgacatcgc cgtcctgtgc accttcatgt cgctcttcct gcaggtcaac atgtacagca gcgtcttctt cctcacctgg atgagcttcg accgctacat cgccctggcc agggccatgc gctgcagcct gttccgcacc aagcaccacg cccggctgag ctgtggcctc atctggatgg catccgtgtc agccacgctg gtgcccttca ccgccgtgca cctgcagcac accgacgagg cctgcttctg tttcgcggat gtccgggagg tgcagtggct cgaggtcacg ctgggcttca tcgtgccctt cgccatcatc ggcctgtgct actccctcat tgtccgggtg ctggtcaggg cgcaccggca ccgtgggctg cggccccggc ggcagaaggc gctccgcatg atcctcgcgg tggtgctggt cttcttcgtc tgctggctgc cggagaacgt cttcatcagc gtgcacctcc tgcagcggac gcagcctggg gccgctccct gcaagcagtc tttccgccat gcccaccccc tcacgggcca cattgtcaac ctcgccgcct tctccaacag ctgcctaaac cccctcatct acagctttct cggggagacc ttcagggaca agctgaggct gtacattgag cagaaaacaa atttgccggc cctgaaccgc ttctgtcacg ctgccctgaa ggccgtcatt ccagacagca ctgagcagtc ggatgtgagg ttcagcagtg ccgtgtag. It is sometimes possible for the material contained within the vial of "GPER, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.