Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DBF4B cdna clone

DBF4B cDNA Clone

Gene Names
DBF4B; DRF1; ASKL1; CHIFB; ZDBF1B
Synonyms
DBF4B; DBF4B cDNA Clone; DBF4B cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgaaccgggaaagggagacgattgcctcgagctggagagttccatggctgagagtaggctccgggccccggacctaggagtttccaggtgtctaggaaaatgccagaagaactcaccaggtgccaggaagcatcccttttccggaaagtccttttacttggatctgcctgctggcaagaatctccagtttttgacgggggccattcagcaactgggtggggtaattgagggttttctgagcaaagaagtaagttacatcgtgtccagccgcagagaagtaaaggcagagagcagtgggaaaagccatagaggctgccctagccctagccccagtgaggtcagagtggaaacatcggccatggttgatccaaaaggcagccaccccaggccttcacggaaacccgttgactcggtgcctctaagcagagggaaggagctgctgcagaaggctatcagaaaccaggggagcatcagtggaggaggcagtgggggcagcagcagcctcctgaccaatgcccgctcttggggagtgaggattctgcacgtggatgaaatgatgatgcacgtgcaacagctgtctcttgcgtctttatgtgtgaaaaaacaacagccaaagaagccagagggaacatgtccagcagcagagtcaagaacacggaaagtggccagactgaaggccccgttcctcaaaatcgaagatgaaagcaggaagtttcgtcctttccatcatcagtttaaatcctttcctgaaatttcttttcttggacccaaagatgcaagtccctttgaggccccgacgaccctgggcagcatgcaccataccagagaatccaaggatggagagccaagcccacgatcagctgcccacaccatgcccaggaggaagaaaggctactgcgagtgctgtcaggaggccttcgaggagctccatgtgcatcttcagagtgcccagcaccggagctttgccctggaagcccatctatatgcagaagtggacaggatcattgctcagctcagccacagctttgcagacatccctttccaggctggcctccccaggtggtcaggttccccagcttctgattgtgaccctctctgtcctgagactctgcacccccatcagccctcccatcccagggcagcatctcccaggataaggaaagaagacagctgccaggcatcagtgacccaaggcagggctgcgggccagcagcgatggacagaatcactagatggtgtgatgggacctcctgcaagtcacacatgtcacaggccttgccgtctgccctga
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,392 Da
NCBI Official Full Name
Homo sapiens DBF4 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
DBF4 zinc finger B
NCBI Official Symbol
DBF4B
NCBI Official Synonym Symbols
DRF1; ASKL1; CHIFB; ZDBF1B
NCBI Protein Information
protein DBF4 homolog B
UniProt Protein Name
Protein DBF4 homolog B
Protein Family
UniProt Gene Name
DBF4B
UniProt Synonym Gene Names
ASKL1; DRF1; ASK-like protein 1
UniProt Entry Name
DBF4B_HUMAN

NCBI Description

This gene encodes a regulator of the cell division cycle 7 homolog (S. cerevisiae) protein, a serine-threonine kinase which links cell cycle regulation to genome duplication. This protein localizes to the nucleus and, in complex with the cell division cycle 7 homolog (S. cerevisiae) protein, may facilitate M phase progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]

Uniprot Description

DBF4B: Regulatory subunit for CDC7 which activates its kinase activity thereby playing a central role in DNA replication and cell proliferation. Required for progression of S and M phases. The complex CDC7-DBF4B selectively phosphorylates MCM2 subunit at 'Ser-40' and then is involved in regulating the initiation of DNA replication during cell cycle. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 17q21.31|17q21

Cellular Component: cytoplasm; intracellular membrane-bound organelle; nuclear chromatin; nucleoplasm; nucleus

Molecular Function: protein binding; protein kinase activator activity; protein kinase binding

Biological Process: positive regulation of cell proliferation

Research Articles on DBF4B

Similar Products

Product Notes

The DBF4B dbf4b (Catalog #AAA1273699) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgaac cgggaaaggg agacgattgc ctcgagctgg agagttccat ggctgagagt aggctccggg ccccggacct aggagtttcc aggtgtctag gaaaatgcca gaagaactca ccaggtgcca ggaagcatcc cttttccgga aagtcctttt acttggatct gcctgctggc aagaatctcc agtttttgac gggggccatt cagcaactgg gtggggtaat tgagggtttt ctgagcaaag aagtaagtta catcgtgtcc agccgcagag aagtaaaggc agagagcagt gggaaaagcc atagaggctg ccctagccct agccccagtg aggtcagagt ggaaacatcg gccatggttg atccaaaagg cagccacccc aggccttcac ggaaacccgt tgactcggtg cctctaagca gagggaagga gctgctgcag aaggctatca gaaaccaggg gagcatcagt ggaggaggca gtgggggcag cagcagcctc ctgaccaatg cccgctcttg gggagtgagg attctgcacg tggatgaaat gatgatgcac gtgcaacagc tgtctcttgc gtctttatgt gtgaaaaaac aacagccaaa gaagccagag ggaacatgtc cagcagcaga gtcaagaaca cggaaagtgg ccagactgaa ggccccgttc ctcaaaatcg aagatgaaag caggaagttt cgtcctttcc atcatcagtt taaatccttt cctgaaattt cttttcttgg acccaaagat gcaagtccct ttgaggcccc gacgaccctg ggcagcatgc accataccag agaatccaag gatggagagc caagcccacg atcagctgcc cacaccatgc ccaggaggaa gaaaggctac tgcgagtgct gtcaggaggc cttcgaggag ctccatgtgc atcttcagag tgcccagcac cggagctttg ccctggaagc ccatctatat gcagaagtgg acaggatcat tgctcagctc agccacagct ttgcagacat ccctttccag gctggcctcc ccaggtggtc aggttcccca gcttctgatt gtgaccctct ctgtcctgag actctgcacc cccatcagcc ctcccatccc agggcagcat ctcccaggat aaggaaagaa gacagctgcc aggcatcagt gacccaaggc agggctgcgg gccagcagcg atggacagaa tcactagatg gtgtgatggg acctcctgca agtcacacat gtcacaggcc ttgccgtctg ccctga. It is sometimes possible for the material contained within the vial of "DBF4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.