Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNPDA1 cdna clone

GNPDA1 cDNA Clone

Gene Names
GNPDA1; GPI; HLN; GNP1; GNPI; GNPDA
Synonyms
GNPDA1; GNPDA1 cDNA Clone; GNPDA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtggatgctgcctcctcctggctgtttttgtgcctgtttgaagctactgctgcctccatttctgggaaagacctttgagagcctagcccaggcctaa
Sequence Length
102
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,047 Da
NCBI Official Full Name
Homo sapiens glucosamine-6-phosphate deaminase 1, mRNA
NCBI Official Synonym Full Names
glucosamine-6-phosphate deaminase 1
NCBI Official Symbol
GNPDA1
NCBI Official Synonym Symbols
GPI; HLN; GNP1; GNPI; GNPDA
NCBI Protein Information
glucosamine-6-phosphate isomerase 1
UniProt Protein Name
Glucosamine-6-phosphate isomerase 1
UniProt Gene Name
GNPDA1
UniProt Synonym Gene Names
GNPI; HLN; KIAA0060; GNPDA 1; GlcN6P deaminase 1
UniProt Entry Name
GNPI1_HUMAN

NCBI Description

Glucosamine-6-phosphate deaminase (EC 3.5.99.6) is an allosteric enzyme that catalyzes the reversible conversion of D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium (Arreola et al., 2003 [PubMed 12965206]).[supplied by OMIM, Jan 2010]

Uniprot Description

GNPDA1: Seems to trigger calcium oscillations in mammalian eggs. These oscillations serve as the essential trigger for egg activation and early development of the embryo. Belongs to the glucosamine/galactosamine-6-phosphate isomerase family.

Protein type: Carbohydrate Metabolism - amino sugar and nucleotide sugar; Hydrolase; Isomerase; EC 3.5.99.6

Chromosomal Location of Human Ortholog: 5q21

Cellular Component: cytoplasm; cytosol

Molecular Function: glucosamine-6-phosphate deaminase activity; protein binding

Biological Process: generation of precursor metabolites and energy; glucosamine catabolic process; glucose metabolic process; N-acetylglucosamine catabolic process; N-acetylneuraminate catabolic process; single fertilization; UDP-N-acetylglucosamine biosynthetic process

Research Articles on GNPDA1

Similar Products

Product Notes

The GNPDA1 gnpda1 (Catalog #AAA1273687) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtgga tgctgcctcc tcctggctgt ttttgtgcct gtttgaagct actgctgcct ccatttctgg gaaagacctt tgagagccta gcccaggcct aa. It is sometimes possible for the material contained within the vial of "GNPDA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.