Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPCAT1 cdna clone

LPCAT1 cDNA Clone

Gene Names
LPCAT1; AYTL2; lpcat; AGPAT9; PFAAP3; AGPAT10
Synonyms
LPCAT1; LPCAT1 cDNA Clone; LPCAT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgatgtcctccatcgtgatgaaggcagagagcagagacatcccgatctggggaactctgatccagtatatacggcctgtgttcgtgtcccggtcagaccaggattctcgcaggaaaacagtagaagaaatcaagagacgggcgcagtccaacggaaagtggccacagataatgatttttccagaaggaacttgtacaaacaggacctgcctaattaccttcaaacctggtgcattcatccctggagcgcccgtccagcctgtggttttacgatatccaaataaactggacaccatcacatggacgtggcaaggacctggagcgctggaaatcctgtggctcacgctgtgtcagtttcacaaccaagtggaaatcgagttccttcctgtgtacagcccttctgaggaggagaagaggaaccccgcgctgtatgccagcaacgtgcggcgagtcatggccgaggccttgggtgtctccgtgactgactacacgttcgaggactgccagctggccctggcggaaggacagctccgtctccccgctgacacttgccttttagaatttgccaggctcgtgcggggcctcgggctaaaaccagaaaagcttgaaaaagatctggacagatactcagaaagagccaggatgaagggaggagagaagataggtattgcggagtttgccgcctccctggaagtccccgtttctgacttgctggaagacatgttttcactgttcgacgagagcggcagcggcgaggtggacctgcgagagtgtgtggttgccctgtctgtcgtctgccggccggcccggaccctggacaccatccagctggctttcaagatgtacggagcgcaagaggacggcagcgtcggcgaaggtgacctgtcctgcatcctcaagacggccctgggggtggcagagctcaccgtgaccgacctattccgagccattgaccaagaggagaaggggaagatcacattcgctgacttccacaggtttgcagaaatgtaccctgccttcgcagaggaatacctgtacccggatcagacacatttcgaaagctgtgcagagacctcacctgcgccaatcccaaacggcttctgtgccgatttcagcccggaaaactcagacgctgggcggaagcctgttcgcaagaagctggattag
Sequence Length
1170
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,151 Da
NCBI Official Full Name
Homo sapiens lysophosphatidylcholine acyltransferase 1, mRNA
NCBI Official Synonym Full Names
lysophosphatidylcholine acyltransferase 1
NCBI Official Symbol
LPCAT1
NCBI Official Synonym Symbols
AYTL2; lpcat; AGPAT9; PFAAP3; AGPAT10
NCBI Protein Information
lysophosphatidylcholine acyltransferase 1
UniProt Protein Name
Lysophosphatidylcholine acyltransferase 1
UniProt Gene Name
LPCAT1
UniProt Synonym Gene Names
AYTL2; PFAAP3; LPC acyltransferase 1; LPCAT-1; LysoPC acyltransferase 1; Acetyl-CoA:lyso-PAF acetyltransferase; Lyso-PAF acetyltransferase; LysoPAFAT
UniProt Entry Name
PCAT1_HUMAN

NCBI Description

Lysophosphatidylcholine (LPC) acyltransferase (LPCAT; EC 2.3.1.23) catalyzes the conversion of LPC to phosphatidylcholine (PC) in the remodeling pathway of PC biosynthesis (Nakanishi et al., 2006 [PubMed 16704971]).[supplied by OMIM, May 2008]

Uniprot Description

LPCAT1: Possesses both acyltransferase and acetyltransferase activities. Activity is calcium-independent. Mediates the conversion of 1-acyl-sn-glycero-3-phosphocholine (LPC) into phosphatidylcholine (PC). Displays a clear preference for saturated fatty acyl-CoAs, and 1-myristoyl or 1-palmitoyl LPC as acyl donors and acceptors, respectively. May synthesize phosphatidylcholine in pulmonary surfactant, thereby playing a pivotal role in respiratory physiology. Belongs to the 1-acyl-sn-glycerol-3-phosphate acyltransferase family.

Protein type: Acetyltransferase; EC 2.3.1.67; Membrane protein, integral; Endoplasmic reticulum; EC 2.3.1.23

Chromosomal Location of Human Ortholog: 5p15.33

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; Golgi apparatus; lipid particle; membrane

Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; 1-acylglycerophosphocholine O-acyltransferase activity; 2-acylglycerol-3-phosphate O-acyltransferase activity

Biological Process: phosphatidic acid biosynthetic process; phospholipid biosynthetic process; triacylglycerol biosynthetic process

Research Articles on LPCAT1

Similar Products

Product Notes

The LPCAT1 lpcat1 (Catalog #AAA1273547) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgatgt cctccatcgt gatgaaggca gagagcagag acatcccgat ctggggaact ctgatccagt atatacggcc tgtgttcgtg tcccggtcag accaggattc tcgcaggaaa acagtagaag aaatcaagag acgggcgcag tccaacggaa agtggccaca gataatgatt tttccagaag gaacttgtac aaacaggacc tgcctaatta ccttcaaacc tggtgcattc atccctggag cgcccgtcca gcctgtggtt ttacgatatc caaataaact ggacaccatc acatggacgt ggcaaggacc tggagcgctg gaaatcctgt ggctcacgct gtgtcagttt cacaaccaag tggaaatcga gttccttcct gtgtacagcc cttctgagga ggagaagagg aaccccgcgc tgtatgccag caacgtgcgg cgagtcatgg ccgaggcctt gggtgtctcc gtgactgact acacgttcga ggactgccag ctggccctgg cggaaggaca gctccgtctc cccgctgaca cttgcctttt agaatttgcc aggctcgtgc ggggcctcgg gctaaaacca gaaaagcttg aaaaagatct ggacagatac tcagaaagag ccaggatgaa gggaggagag aagataggta ttgcggagtt tgccgcctcc ctggaagtcc ccgtttctga cttgctggaa gacatgtttt cactgttcga cgagagcggc agcggcgagg tggacctgcg agagtgtgtg gttgccctgt ctgtcgtctg ccggccggcc cggaccctgg acaccatcca gctggctttc aagatgtacg gagcgcaaga ggacggcagc gtcggcgaag gtgacctgtc ctgcatcctc aagacggccc tgggggtggc agagctcacc gtgaccgacc tattccgagc cattgaccaa gaggagaagg ggaagatcac attcgctgac ttccacaggt ttgcagaaat gtaccctgcc ttcgcagagg aatacctgta cccggatcag acacatttcg aaagctgtgc agagacctca cctgcgccaa tcccaaacgg cttctgtgcc gatttcagcc cggaaaactc agacgctggg cggaagcctg ttcgcaagaa gctggattag. It is sometimes possible for the material contained within the vial of "LPCAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.