Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KRT33B cdna clone

KRT33B cDNA Clone

Gene Names
KRT33B; K33B; HA3II; Ha-3II; KRTHA3A; KRTHA3B; hHa3-II
Synonyms
KRT33B; KRT33B cDNA Clone; KRT33B cdna clone
Ordering
For Research Use Only!
Sequence
atgccctacaacttctgcctgcccagcctgagctgccgcaccagctgctcctcccggccctgtgtgccccccagctgccacggctacaccctgcccggggcctgcaacatccctgccaatgtgagcaactgcaactggttctgcgagggctccttcaatggcagcgagaaggagactatgcagttcctgaacgaccgcctggccagctacctggagaaggtgcgtcagctggagcgggacaacgcggagctggagaacctcatccgggagcggtctcagcagcaggagcccttgctgtgccccagctaccagtcctacttcaagaccattgaggagctccagcagaagatcctgtgcagcaagtctgagaatgccaggctggtggtgcagatcgacaatgccaagctggctgcagatgacttcagaaccaagtaccagacggagcagtccctgcggcagctggtggagtccgacatcaacagcctgcgcaggattctggatgagctgaccctgtgcaggtctgacctggaggcccagatggagtccctgaaggaggagctgctgtccctcaagcagaaccatgagcaggaagtcaacaccttgcgctgccagcttggagaccgcctcaacgtggaggtggacgctgctcccgctgtggacctgaaccaggtcctgaacgagaccaggaatcagtatgaggccctggtggaaaccaaccgcagggaagtggagcaatggttcgccacgcagaccgaggagctgaacaagcaggtggtatccagctcggagcagctgcagtcctaccaggcggagatcatcgagctgagacgcacagtcaatgccctggagatcgagctgcaggcccagcacaacctgcgatactctctggaaaacacgctgacagagagcgaggcccgctacagctcccagctgtcccaggtgcagagcctgatcaccaacgtggagtcccagctggcggagatccgcagtgacctggagcggcagaaccaggagtatcaggtgctgctggacgtgcgggcgcggctggagtgtgagatcaacacataccggagcctgctggagagcgaggactgcaagctgccctccaacccctgcgccaccaccaatgcatgtgaaaagcccattggatcctgtgtcaccaatccttgtggtcctcgttcccgctgtgggccttgcaacacctttgggtactag
Sequence Length
1215
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,214 Da
NCBI Official Full Name
Homo sapiens keratin 33B, mRNA
NCBI Official Synonym Full Names
keratin 33B
NCBI Official Symbol
KRT33B
NCBI Official Synonym Symbols
K33B; HA3II; Ha-3II; KRTHA3A; KRTHA3B; hHa3-II
NCBI Protein Information
keratin, type I cuticular Ha3-II
UniProt Protein Name
Keratin, type I cuticular Ha3-II
Protein Family
UniProt Gene Name
KRT33B
UniProt Synonym Gene Names
HHA3-II; HKA3B; KRTHA3B; K33B
UniProt Entry Name
KT33B_HUMAN

NCBI Description

This gene encodes a member of the keratin gene family. This gene is one of multiple type I hair keratin genes that are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. As a type I hair keratin, the encoded protein is an acidic protein which heterodimerizes with type II keratins to form hair and nails. There are two isoforms of this protein, encoded by two separate genes, keratin 33A and keratin 33B. [provided by RefSeq, May 2012]

Uniprot Description

KRT33B: a member of the keratin gene family. This gene is one of multiple type I hair keratin genes that are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. As a type I hair keratin, the encoded protein is an acidic protein which heterodimerizes with type II keratins to form hair and nails. There are two isoforms of this protein, encoded by two separate genes, keratin 33A and keratin 33B. [provided by RefSeq, May 2012]

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q21.2

Cellular Component: extracellular space

Molecular Function: protein binding

Biological Process: aging; hair cycle

Similar Products

Product Notes

The KRT33B krt33b (Catalog #AAA1273528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctaca acttctgcct gcccagcctg agctgccgca ccagctgctc ctcccggccc tgtgtgcccc ccagctgcca cggctacacc ctgcccgggg cctgcaacat ccctgccaat gtgagcaact gcaactggtt ctgcgagggc tccttcaatg gcagcgagaa ggagactatg cagttcctga acgaccgcct ggccagctac ctggagaagg tgcgtcagct ggagcgggac aacgcggagc tggagaacct catccgggag cggtctcagc agcaggagcc cttgctgtgc cccagctacc agtcctactt caagaccatt gaggagctcc agcagaagat cctgtgcagc aagtctgaga atgccaggct ggtggtgcag atcgacaatg ccaagctggc tgcagatgac ttcagaacca agtaccagac ggagcagtcc ctgcggcagc tggtggagtc cgacatcaac agcctgcgca ggattctgga tgagctgacc ctgtgcaggt ctgacctgga ggcccagatg gagtccctga aggaggagct gctgtccctc aagcagaacc atgagcagga agtcaacacc ttgcgctgcc agcttggaga ccgcctcaac gtggaggtgg acgctgctcc cgctgtggac ctgaaccagg tcctgaacga gaccaggaat cagtatgagg ccctggtgga aaccaaccgc agggaagtgg agcaatggtt cgccacgcag accgaggagc tgaacaagca ggtggtatcc agctcggagc agctgcagtc ctaccaggcg gagatcatcg agctgagacg cacagtcaat gccctggaga tcgagctgca ggcccagcac aacctgcgat actctctgga aaacacgctg acagagagcg aggcccgcta cagctcccag ctgtcccagg tgcagagcct gatcaccaac gtggagtccc agctggcgga gatccgcagt gacctggagc ggcagaacca ggagtatcag gtgctgctgg acgtgcgggc gcggctggag tgtgagatca acacataccg gagcctgctg gagagcgagg actgcaagct gccctccaac ccctgcgcca ccaccaatgc atgtgaaaag cccattggat cctgtgtcac caatccttgt ggtcctcgtt cccgctgtgg gccttgcaac acctttgggt actag. It is sometimes possible for the material contained within the vial of "KRT33B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.