Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB32 cdna clone

RAB32 cDNA Clone

Synonyms
RAB32; RAB32 cDNA Clone; RAB32 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggcggaggagccggggaccccggcctgggggcggccgccgccccagcgcccgagacccgcgagcacctcttcaaggtgctggtgatcggcgagcttggcgtgggcaagaccagcatcatcaagcgctacgtccaccagctcttctcccagcactaccgggccaccatcggggtggacttcgccctcaaggtcctcaactgggacagcaggactctggtgcgcctgcagctgtgggacatcgcggggcaggagcgatttggcaacatgacccgagtatactacaaggaagctgttggtgcttttgtagtctttgatatatcaagaagttccacatttgaggcagtcttaaaatggaaaagtgatctggatagtaaagttcatcttccaaatggcagccctatccctgctgtcctcttggctaacaaatgtgaccagaacaaggacagtagccagagtccttcccaggtggaccaattctgcaaagaacatggctttgccggatggtttgaaacctctgcaaaggataacataaacatagaggaagctgcccggttcctagtggagaagattcttgtaaaccaccaaagctttcctaatgaagaaaacgatgtggacaaaattaagctagatcaagagaccttgagagcagagaacaaatcccagtgttgctga
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,997 Da
NCBI Official Full Name
Homo sapiens RAB32, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB32, member RAS oncogene family
NCBI Official Symbol
RAB32
NCBI Protein Information
ras-related protein Rab-32
UniProt Protein Name
Ras-related protein Rab-32
Protein Family
UniProt Gene Name
RAB32
UniProt Entry Name
RAB32_HUMAN

NCBI Description

The protein encoded by this gene anchors the type II regulatory subunit of protein kinase A to the mitochondrion and aids in mitochondrial fission. The encoded protein also appears to be involved in autophagy and melanosome secretion. Variations in this gene may be linked to leprosy. [provided by RefSeq, Dec 2015]

Uniprot Description

RAB32: Acts as an A-kinase anchoring protein by binding to the type II regulatory subunit of protein kinase A and anchoring it to the mitochondrion. Also involved in synchronization of mitochondrial fission. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric, Rab; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: 6q24.3

Cellular Component: early endosome; endoplasmic reticulum; melanosome; membrane; mitochondrion; phagocytic vesicle; trans-Golgi network

Molecular Function: GTP-dependent protein binding; GTPase activity; protein binding

Biological Process: antigen processing and presentation

Research Articles on RAB32

Similar Products

Product Notes

The RAB32 rab32 (Catalog #AAA1273332) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggcg gaggagccgg ggaccccggc ctgggggcgg ccgccgcccc agcgcccgag acccgcgagc acctcttcaa ggtgctggtg atcggcgagc ttggcgtggg caagaccagc atcatcaagc gctacgtcca ccagctcttc tcccagcact accgggccac catcggggtg gacttcgccc tcaaggtcct caactgggac agcaggactc tggtgcgcct gcagctgtgg gacatcgcgg ggcaggagcg atttggcaac atgacccgag tatactacaa ggaagctgtt ggtgcttttg tagtctttga tatatcaaga agttccacat ttgaggcagt cttaaaatgg aaaagtgatc tggatagtaa agttcatctt ccaaatggca gccctatccc tgctgtcctc ttggctaaca aatgtgacca gaacaaggac agtagccaga gtccttccca ggtggaccaa ttctgcaaag aacatggctt tgccggatgg tttgaaacct ctgcaaagga taacataaac atagaggaag ctgcccggtt cctagtggag aagattcttg taaaccacca aagctttcct aatgaagaaa acgatgtgga caaaattaag ctagatcaag agaccttgag agcagagaac aaatcccagt gttgctga. It is sometimes possible for the material contained within the vial of "RAB32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.