Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BTG2 cdna clone

BTG2 cDNA Clone

Gene Names
BTG2; PC3; APRO1; TIS21
Synonyms
BTG2; BTG2 cDNA Clone; BTG2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGCCACGGGAAGGGAACCGACATGCTCCCGGAGATCGCCGCCGCCGTGGGCTTCCTCTCCAGCCTCCTGAGGACCCGGGGCTGCGTGAGCGAGCAGAGGCTTAAGGTCTTCAGCGGGGCGCTCCAGGAGGCACTCACAGAGCACTACAAACACCACTGGTTTCCCGAAAAGCCGTCCAAGGGCTCCGGCTACCGCTGCATTCGCATCAACCACAAGATGGACCCCATCATCAGCAGGGTGGCCAGCCAGATCGGACTCAGCCAGCCCCAGCTGCACCAGCTGCTGCCCAGCGAGCTGACCCTGTGGGTGGACCCCTATGAGGTGTCCTACCGCATTGGGGAGGACGGCTCCATCTGCGTCTTGTACGAGGAGGCCCCACTGGCCGCCTCCTGTGGGCTCCTCACCTGCAAGAACCAAGTGCTGCTGGGCCGGAGCAGCCCCTCCAAGAACTACGTGATGGCAGTCTCCAGCTAG
Sequence Length
477
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,416 Da
NCBI Official Full Name
Homo sapiens BTG family, member 2, mRNA
NCBI Official Synonym Full Names
BTG anti-proliferation factor 2
NCBI Official Symbol
BTG2
NCBI Official Synonym Symbols
PC3; APRO1; TIS21
NCBI Protein Information
protein BTG2
UniProt Protein Name
Protein BTG2
Protein Family
UniProt Gene Name
BTG2
UniProt Synonym Gene Names
PC3
UniProt Entry Name
BTG2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein is involved in the regulation of the G1/S transition of the cell cycle. [provided by RefSeq, Jul 2008]

Uniprot Description

BTG2: Involved in cell cycle regulation. Could be involved in the growth arrest and differentiation of the neuronal precursors. Anti-proliferative protein. Modulates transcription regulation mediated by ESR1. Involved in mitochondrial depolarization and neurite outgrowth. Belongs to the BTG family.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; DNA repair; negative regulation of cell proliferation; negative regulation of translation; neurite development; response to DNA damage stimulus

Research Articles on BTG2

Similar Products

Product Notes

The BTG2 btg2 (Catalog #AAA1273311) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGCCACG GGAAGGGAAC CGACATGCTC CCGGAGATCG CCGCCGCCGT GGGCTTCCTC TCCAGCCTCC TGAGGACCCG GGGCTGCGTG AGCGAGCAGA GGCTTAAGGT CTTCAGCGGG GCGCTCCAGG AGGCACTCAC AGAGCACTAC AAACACCACT GGTTTCCCGA AAAGCCGTCC AAGGGCTCCG GCTACCGCTG CATTCGCATC AACCACAAGA TGGACCCCAT CATCAGCAGG GTGGCCAGCC AGATCGGACT CAGCCAGCCC CAGCTGCACC AGCTGCTGCC CAGCGAGCTG ACCCTGTGGG TGGACCCCTA TGAGGTGTCC TACCGCATTG GGGAGGACGG CTCCATCTGC GTCTTGTACG AGGAGGCCCC ACTGGCCGCC TCCTGTGGGC TCCTCACCTG CAAGAACCAA GTGCTGCTGG GCCGGAGCAG CCCCTCCAAG AACTACGTGA TGGCAGTCTC CAGCTAG. It is sometimes possible for the material contained within the vial of "BTG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.