Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LNX1 cdna clone

LNX1 cDNA Clone

Gene Names
LNX1; LNX; MPDZ; PDZRN2
Synonyms
LNX1; LNX1 cDNA Clone; LNX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcgcttctgttgctggtcttgccttggctcagtcctgctaactacattgacaatgtgggcaacctgcacttcctgtattcagaactctgtaaaggtgcctcccactacggcctgaccaaagataggaagaggcgctcacaagatggctgtccagacggctgtgcgagcctcacagccacggctccctccccagaggtttctgcagctgccaccatctccttaatgacagacgagcctggcctagacaaccctgcctacgtgtcctcggcagaggacgggcagccagcaatcagcccagtggactctggccggagcaaccgaactagggcacggccctttgagagatccactattagaagcagatcatttaaaaaaataaatcgagctttgagtgttcttcgaaggacaaagagcgggagtgcagttgccaaccatgccgaccagggcagggaaaattctgaaaacaccactgcccctgaagtctttccaaggttgtaccacctgattccagatggtgaaattaccagcatcaagatcaatcgagtagatcccagtgaaagcctctctattaggctggtgggaggtagcgaaaccccactggtccatatcattatccaacacatttatcgtgatggggtgatcgccagagacggccggctactgccaggagacatcattctaaaggtcaacgggatggacatcagcaatgtccctcacaactacgctgtgcgtctcctgcggcagccctgccaggtgctgtggctgactgtgatgcgtgaacagaagttccgcagcaggaacaatggacaggccccggatgcctacagaccccgagatgacagctttcatgtgattctcaacaaaagtagccccgaggagcagcttggaataaaactggtgcgcaaggtggatgagcctggggttttcatcttcaatgtgctggatggcggtgtggcatatcgacatggtcagcttgaggagaatgaccgtgtgttagccatcaatggacatgatcttcgatatggcagcccagaaagtgcggctcatctgattcaggccagtgaaagacgtgttcacctcgtcgtgtcccgccaggttcggcagcggagccctgacatctttcaggaagccggctggaacagcaatggcagctggtccccagggccaggggagaggagcaacactcccaagcccctccatcctacaattacttgtcatgagaaggtggtaaatatccaaaaagaccccggtgaatctctcggcatgaccgtcgcagggggagcatcacatagagaatgggatttgcctatctatgtcatcagtgttgagcccggaggagtcataagcagagatggaagaataaaaacaggtgacattttgttgaatgtggatggggtcgaactgacagaggtcagccggagtgaggcagtggcattattgaaaagaacatcatcctcgatagtactcaaagctttggaagtcaaagagtatgagccccaggaagactgcagcagcccagcagccctggactccaaccacaacatggccccacccagtgactggtccccatcctgggtcatgtggctggaattaccacggtgcttgtataactgtaaagatattgtattacgaagaaacacagctggaagtctgggcttctgcattgtaggaggttatgaagaatacaatggaaacaaaccttttttcatcaaatccattgttgaaggaacaccagcatacaatgatggaagaattagatgtggtgatattcttcttgctgtcaatggtagaagtacatcaggaatgatacatgcttgcttggcaagactgctgaaagaacttaaaggaagaattactctaactattgtttcttggcctggcacttttttatag
Sequence Length
1899
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,643 Da
NCBI Official Full Name
Homo sapiens ligand of numb-protein X 1, mRNA
NCBI Official Synonym Full Names
ligand of numb-protein X 1
NCBI Official Symbol
LNX1
NCBI Official Synonym Symbols
LNX; MPDZ; PDZRN2
NCBI Protein Information
E3 ubiquitin-protein ligase LNX
UniProt Protein Name
E3 ubiquitin-protein ligase LNX
UniProt Gene Name
LNX1
UniProt Synonym Gene Names
LNX; PDZRN2
UniProt Entry Name
LNX1_HUMAN

NCBI Description

This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

LNX1: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of NUMB. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Mediates ubiquitination of isoform p66 and isoform p72 of NUMB, but not that of isoform p71 or isoform p65. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ligase; Adaptor/scaffold; EC 6.3.2.-; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 4q12

Molecular Function: protein binding

Research Articles on LNX1

Similar Products

Product Notes

The LNX1 lnx1 (Catalog #AAA1273248) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcgc ttctgttgct ggtcttgcct tggctcagtc ctgctaacta cattgacaat gtgggcaacc tgcacttcct gtattcagaa ctctgtaaag gtgcctccca ctacggcctg accaaagata ggaagaggcg ctcacaagat ggctgtccag acggctgtgc gagcctcaca gccacggctc cctccccaga ggtttctgca gctgccacca tctccttaat gacagacgag cctggcctag acaaccctgc ctacgtgtcc tcggcagagg acgggcagcc agcaatcagc ccagtggact ctggccggag caaccgaact agggcacggc cctttgagag atccactatt agaagcagat catttaaaaa aataaatcga gctttgagtg ttcttcgaag gacaaagagc gggagtgcag ttgccaacca tgccgaccag ggcagggaaa attctgaaaa caccactgcc cctgaagtct ttccaaggtt gtaccacctg attccagatg gtgaaattac cagcatcaag atcaatcgag tagatcccag tgaaagcctc tctattaggc tggtgggagg tagcgaaacc ccactggtcc atatcattat ccaacacatt tatcgtgatg gggtgatcgc cagagacggc cggctactgc caggagacat cattctaaag gtcaacggga tggacatcag caatgtccct cacaactacg ctgtgcgtct cctgcggcag ccctgccagg tgctgtggct gactgtgatg cgtgaacaga agttccgcag caggaacaat ggacaggccc cggatgccta cagaccccga gatgacagct ttcatgtgat tctcaacaaa agtagccccg aggagcagct tggaataaaa ctggtgcgca aggtggatga gcctggggtt ttcatcttca atgtgctgga tggcggtgtg gcatatcgac atggtcagct tgaggagaat gaccgtgtgt tagccatcaa tggacatgat cttcgatatg gcagcccaga aagtgcggct catctgattc aggccagtga aagacgtgtt cacctcgtcg tgtcccgcca ggttcggcag cggagccctg acatctttca ggaagccggc tggaacagca atggcagctg gtccccaggg ccaggggaga ggagcaacac tcccaagccc ctccatccta caattacttg tcatgagaag gtggtaaata tccaaaaaga ccccggtgaa tctctcggca tgaccgtcgc agggggagca tcacatagag aatgggattt gcctatctat gtcatcagtg ttgagcccgg aggagtcata agcagagatg gaagaataaa aacaggtgac attttgttga atgtggatgg ggtcgaactg acagaggtca gccggagtga ggcagtggca ttattgaaaa gaacatcatc ctcgatagta ctcaaagctt tggaagtcaa agagtatgag ccccaggaag actgcagcag cccagcagcc ctggactcca accacaacat ggccccaccc agtgactggt ccccatcctg ggtcatgtgg ctggaattac cacggtgctt gtataactgt aaagatattg tattacgaag aaacacagct ggaagtctgg gcttctgcat tgtaggaggt tatgaagaat acaatggaaa caaacctttt ttcatcaaat ccattgttga aggaacacca gcatacaatg atggaagaat tagatgtggt gatattcttc ttgctgtcaa tggtagaagt acatcaggaa tgatacatgc ttgcttggca agactgctga aagaacttaa aggaagaatt actctaacta ttgtttcttg gcctggcact tttttatag. It is sometimes possible for the material contained within the vial of "LNX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.