Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYNC1H1 cdna clone

DYNC1H1 cDNA Clone

Gene Names
DYNC1H1; p22; DHC1; DNCL; DYHC; HL-3; CMT2O; DHC1a; DNCH1; DNECL; Dnchc1; SMALED1
Synonyms
DYNC1H1; DYNC1H1 cDNA Clone; DYNC1H1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatcagtaaaatgctgaagatgcagatgttggaggatgaggacgacctggcctacgcagagaccgagaagaagacgaggacagactccacgtccgacgggcgccctgcctggatgcggacactgcacaccaccgcgtccaactggctgcacctcatcccccagacgctgagccacctcaagcgcaccgtggagaatatcaaggatcctttgttcaggttctttgagagagaagtgaagatgggcgcaaagctgcttcaggacgttcgccaggaccttgcagatgtcgtccaggtgtgcgaaggaaagaagaagcagaccaactacttgcgcacgctgatcaacgagctagtgaaagggatcttgcctcggagctggtcccactacacggtgcctgccggcatgaccgtcatccagtgggtgtccgacttcagcgagaggatcaaacagctgcagaacatctcactggcagctgcatctggtggcgccaaggagctaaaggtgaaggcgctcctgacgagtctcgggtggtcagcagctgtcctgggctggggtgggagtggctctggggaaaaacacagggcccaggtctga
Sequence Length
594
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
532,408 Da
NCBI Official Full Name
Homo sapiens dynein, cytoplasmic 1, heavy chain 1, mRNA
NCBI Official Synonym Full Names
dynein cytoplasmic 1 heavy chain 1
NCBI Official Symbol
DYNC1H1
NCBI Official Synonym Symbols
p22; DHC1; DNCL; DYHC; HL-3; CMT2O; DHC1a; DNCH1; DNECL; Dnchc1; SMALED1
NCBI Protein Information
cytoplasmic dynein 1 heavy chain 1
UniProt Protein Name
Cytoplasmic dynein 1 heavy chain 1
Protein Family
UniProt Gene Name
DYNC1H1
UniProt Synonym Gene Names
DHC1; DNCH1; DNCL; DNECL; DYHC; KIAA0325
UniProt Entry Name
DYHC1_HUMAN

NCBI Description

Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]

Uniprot Description

DNCH1: Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Defects in DYNC1H1 are the cause of Charcot-Marie-Tooth disease type 2O (CMT2O). CMT2O is anaxonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. Nerve conduction velocities are normal or slightly reduced. Defects in DYNC1H1 are the cause of mental retardation autosomal dominant type 13 (MRD13). A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. MRD13 is associated with variable neuronal migration defects and mild dysmorphic features. Some patients may also show signs of peripheral neuropathy, such as abnormal gait and hyporeflexia. Defects in DYNC1H1 are the cause of spinal muscular atrophy, lower extremity, autosomal dominant (SMALED). A form of spinal muscular atrophy, a neuromuscular disorder characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMALED is characterized by muscle weakness predominantly affecting the proximal lower extremities. Belongs to the dynein heavy chain family.

Protein type: Microtubule-binding; Motor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 14q32

Cellular Component: centrosome; cytoplasmic dynein complex; cytosol; extracellular matrix; membrane; microtubule

Molecular Function: dynein light intermediate chain binding; protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; cytoplasmic mRNA processing body assembly; ER to Golgi vesicle-mediated transport; establishment of spindle localization; G2/M transition of mitotic cell cycle; stress granule assembly

Disease: Charcot-marie-tooth Disease, Axonal, Type 2o; Mental Retardation, Autosomal Dominant 13; Spinal Muscular Atrophy, Lower Extremity-predominant, 1, Autosomal Dominant

Research Articles on DYNC1H1

Similar Products

Product Notes

The DYNC1H1 dync1h1 (Catalog #AAA1273237) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcagta aaatgctgaa gatgcagatg ttggaggatg aggacgacct ggcctacgca gagaccgaga agaagacgag gacagactcc acgtccgacg ggcgccctgc ctggatgcgg acactgcaca ccaccgcgtc caactggctg cacctcatcc cccagacgct gagccacctc aagcgcaccg tggagaatat caaggatcct ttgttcaggt tctttgagag agaagtgaag atgggcgcaa agctgcttca ggacgttcgc caggaccttg cagatgtcgt ccaggtgtgc gaaggaaaga agaagcagac caactacttg cgcacgctga tcaacgagct agtgaaaggg atcttgcctc ggagctggtc ccactacacg gtgcctgccg gcatgaccgt catccagtgg gtgtccgact tcagcgagag gatcaaacag ctgcagaaca tctcactggc agctgcatct ggtggcgcca aggagctaaa ggtgaaggcg ctcctgacga gtctcgggtg gtcagcagct gtcctgggct ggggtgggag tggctctggg gaaaaacaca gggcccaggt ctga. It is sometimes possible for the material contained within the vial of "DYNC1H1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.