Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PREB cdna clone

PREB cDNA Clone

Gene Names
PREB; SEC12
Synonyms
PREB; PREB cDNA Clone; PREB cdna clone
Ordering
For Research Use Only!
Sequence
atgggccggcgccgggcgccagagctgtaccgggctccgttcccgttgtacgcgcttcaggtcgaccccagcactgggctgctcatcgctgcgggcggaggaggcgccgccaagacaggcataaagaatggcgtgcactttctgcagctagagctgattaatgggcgcttgagtgcctccttgctgcactcccatgacacagagacacgggccaccatgaacttggcactggctggtgacatccttgctgcagggcaggatgcccactgtcagctcctgcgcttccaggcacatcaacagcagggcaacaaggcagagaaggccggttccaaggagcaggggcctcgacaaaggaagggagcagccccagcagagaagaaatgtggagcggaaacccagcacgaggggctagaactcagggtagagaatttgcaggcggtgcagacagactttagctccgatccactgcagaaagttgtgtgcttcaaccacgataataccctgcttgccactggaggaacagatggctacgtccgtgtctggaaggtgcccagcctggagaaggttctggagttcaaagcccacgaaggggagattgaagacctggctttagggcctgatggcaagttggtaaccgtgggccgggaccttaaggcctctgtgtggcagaaggatcagctggtgacacagctgcactggcaagaaaatggacccaccttttccagcacaccttaccgctaccaggcctgcaggtttgggcaggttccagaccagcctgctggcctgcgactcttcacagtgcaaattccccacaagcgcctgcgccagccccctccctgctacctcacagcctgggatggctccaacttcttgccccttcggaccaagtcctgtggccatgaagtcgtctcctgcctcgatgtcagtgaatccggcaccttcctaggcctgggcacagtcactggctctgttgccatctacatagctttctctctccagtgcctctactacgtgagggaggcccatggcattgtggtgacggatgtggcctttctacctgagaagggtcgtggtccagagctccttgggtcccatgaaactgccctgttctctgtggctgtggacagtcgttgccagctgcatctgttgccctcacggcggagtgttcctgtgtggctcctgctcctgctgtgtgtcgggcttattattgtgaccatcctgctgctccagagtgcctttccaggtttcctttag
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,468 Da
NCBI Official Full Name
Homo sapiens prolactin regulatory element binding, mRNA
NCBI Official Synonym Full Names
prolactin regulatory element binding
NCBI Official Symbol
PREB
NCBI Official Synonym Symbols
SEC12
NCBI Protein Information
prolactin regulatory element-binding protein
UniProt Protein Name
Prolactin regulatory element-binding protein
Protein Family
UniProt Gene Name
PREB
UniProt Synonym Gene Names
SEC12
UniProt Entry Name
PREB_HUMAN

NCBI Description

This gene encodes a protein that specifically binds to a Pit1-binding element of the prolactin (PRL) promoter. This protein may act as a transcriptional regulator and is thought to be involved in some of the developmental abnormalities observed in patients with partial trisomy 2p. This gene overlaps the abhydrolase domain containing 1 (ABHD1) gene on the opposite strand. [provided by RefSeq, Jul 2008]

Uniprot Description

PREB: Was first identified based on its probable role in the regulation of pituitary gene transcription. Binds to the prolactin gene (PRL) promoter and seems to activate transcription. Guanine nucleotide exchange factor that activates SARA2. Required for the formation of COPII transport vesicles from the ER.

Protein type: GEFs, misc.; Membrane protein, integral; Transcription factor

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; membrane; nucleus

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; Sar guanyl-nucleotide exchange factor activity

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; protein exit from endoplasmic reticulum

Research Articles on PREB

Similar Products

Product Notes

The PREB preb (Catalog #AAA1273225) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccggc gccgggcgcc agagctgtac cgggctccgt tcccgttgta cgcgcttcag gtcgacccca gcactgggct gctcatcgct gcgggcggag gaggcgccgc caagacaggc ataaagaatg gcgtgcactt tctgcagcta gagctgatta atgggcgctt gagtgcctcc ttgctgcact cccatgacac agagacacgg gccaccatga acttggcact ggctggtgac atccttgctg cagggcagga tgcccactgt cagctcctgc gcttccaggc acatcaacag cagggcaaca aggcagagaa ggccggttcc aaggagcagg ggcctcgaca aaggaaggga gcagccccag cagagaagaa atgtggagcg gaaacccagc acgaggggct agaactcagg gtagagaatt tgcaggcggt gcagacagac tttagctccg atccactgca gaaagttgtg tgcttcaacc acgataatac cctgcttgcc actggaggaa cagatggcta cgtccgtgtc tggaaggtgc ccagcctgga gaaggttctg gagttcaaag cccacgaagg ggagattgaa gacctggctt tagggcctga tggcaagttg gtaaccgtgg gccgggacct taaggcctct gtgtggcaga aggatcagct ggtgacacag ctgcactggc aagaaaatgg acccaccttt tccagcacac cttaccgcta ccaggcctgc aggtttgggc aggttccaga ccagcctgct ggcctgcgac tcttcacagt gcaaattccc cacaagcgcc tgcgccagcc ccctccctgc tacctcacag cctgggatgg ctccaacttc ttgccccttc ggaccaagtc ctgtggccat gaagtcgtct cctgcctcga tgtcagtgaa tccggcacct tcctaggcct gggcacagtc actggctctg ttgccatcta catagctttc tctctccagt gcctctacta cgtgagggag gcccatggca ttgtggtgac ggatgtggcc tttctacctg agaagggtcg tggtccagag ctccttgggt cccatgaaac tgccctgttc tctgtggctg tggacagtcg ttgccagctg catctgttgc cctcacggcg gagtgttcct gtgtggctcc tgctcctgct gtgtgtcggg cttattattg tgaccatcct gctgctccag agtgcctttc caggtttcct ttag. It is sometimes possible for the material contained within the vial of "PREB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.