SLC12A8 cdna clone
SLC12A8 cDNA Clone
Gene Names
SLC12A8; CCC9
Synonyms
SLC12A8; SLC12A8 cDNA Clone; SLC12A8 cdna clone
Sequence
atgtgttcctgcagcctgaccccggtgcctgagccggtgctcagggagggcgcagaaggcctccactgctctgagcacctgctcttagagaaagctcccagttacggctctgagggacctgcccaaagagtcttggagggcacgctactggaattcaccaaggacatggatcagctcctccagctaaccaggaagcttgagagtagccagcccaggcaaggagagggtaacaggaccccagaaagtcagaagaggaaaagcaagaaggccaccaagcagaccctacaagatagcttcctcttggacctcaaatcccctccttctttccctgtcgagatctctgacaggttgcccgctgcctcctgggaggggcaggagtcctgctggaacaagcagacttccaagagcgaagggactcagcctgagggaacatatggagagcaacttgttcctgagctgtgcaaccaatcagagtccagtggagaagatttcttcctgaagtccaggctccaagaacaagatgtctggagaagatccacttctttctatacccacatgtgcaacccctgggtctccctgttgggggctgttgggtcccttctcatcatgtttgtgatacagtgggtgtataccctggttaacatgggtgttgctgccatcgtgtatttctacattggccgggccagtccagggcttcaccttggatcagcctccaacttcagctttttccggtggatgaggtctctcttgctcccctcctgcaggagcttgcagtccccccaggagcagatcatcttggcgccgtccctggctaaggttgacatggagatgactcagctcacccaggagaatgcagacttcgccactcgggatcgctaccaccactcctccctcgtgaaccgggagcagctgatgcctcactactag
Sequence Length
927
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,799 Da
NCBI Official Full Name
Homo sapiens solute carrier family 12 (potassium/chloride transporters), member 8, mRNA
NCBI Official Synonym Full Names
solute carrier family 12 member 8
NCBI Official Symbol
SLC12A8
NCBI Official Synonym Symbols
CCC9
NCBI Protein Information
solute carrier family 12 member 8
UniProt Protein Name
Solute carrier family 12 member 8
Protein Family
UniProt Gene Name
SLC12A8
UniProt Synonym Gene Names
CCC9
UniProt Entry Name
S12A8_HUMAN
NCBI Description
This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
Uniprot Description
SLC12A8: Cation/chloride cotransporter that may play a role in the control of keratinocyte proliferation. SLC12A8 has been identified as a possible susceptibility gene for psoriasis mapped to chromosome 3q21 (PSORS5). Belongs to the SLC12A transporter family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Transporter, SLC family; Membrane protein, multi-pass; Transporter
Chromosomal Location of Human Ortholog: 3q21.2
Research Articles on SLC12A8
Similar Products
Product Notes
The SLC12A8 slc12a8 (Catalog #AAA1273211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgttcct gcagcctgac cccggtgcct gagccggtgc tcagggaggg cgcagaaggc ctccactgct ctgagcacct gctcttagag aaagctccca gttacggctc tgagggacct gcccaaagag tcttggaggg cacgctactg gaattcacca aggacatgga tcagctcctc cagctaacca ggaagcttga gagtagccag cccaggcaag gagagggtaa caggacccca gaaagtcaga agaggaaaag caagaaggcc accaagcaga ccctacaaga tagcttcctc ttggacctca aatcccctcc ttctttccct gtcgagatct ctgacaggtt gcccgctgcc tcctgggagg ggcaggagtc ctgctggaac aagcagactt ccaagagcga agggactcag cctgagggaa catatggaga gcaacttgtt cctgagctgt gcaaccaatc agagtccagt ggagaagatt tcttcctgaa gtccaggctc caagaacaag atgtctggag aagatccact tctttctata cccacatgtg caacccctgg gtctccctgt tgggggctgt tgggtccctt ctcatcatgt ttgtgataca gtgggtgtat accctggtta acatgggtgt tgctgccatc gtgtatttct acattggccg ggccagtcca gggcttcacc ttggatcagc ctccaacttc agctttttcc ggtggatgag gtctctcttg ctcccctcct gcaggagctt gcagtccccc caggagcaga tcatcttggc gccgtccctg gctaaggttg acatggagat gactcagctc acccaggaga atgcagactt cgccactcgg gatcgctacc accactcctc cctcgtgaac cgggagcagc tgatgcctca ctactag. It is sometimes possible for the material contained within the vial of "SLC12A8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
