Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA6 cdna clone

SERPINA6 cDNA Clone

Gene Names
SERPINA6; CBG
Synonyms
SERPINA6; SERPINA6 cDNA Clone; SERPINA6 cdna clone
Ordering
For Research Use Only!
Sequence
atgccactcctcctgtacacctgtcttctctggctgcccaccagcggcctctggaccgtccaggccatggatcctaacgctgcttatgtgaacatgagtaaccatcaccggggcctggcttcagccaacgttgactttgccttcagcctgtataagcacctagtggccttgagtcccaaaaagaacattttcatctcccctgtgagcatctccatggccttagctatgctgtccctgggcacctgtggccacacacgggcccagcttctccagggcctgggtttcaacctcactgagaggtctgagactgagatccaccagggtttccagcacctgcaccaactctttgcaaagtcagacaccagcttagaaatgaccatgggcaatgccttgtttcttgatggcagcctggagttgctggagtcattctcagcagacatcaagcactactatgagtcagaggtcttggctatgaatttccaggactgggcaacagccagcagacagatcaacagctatgtcaagaataagacacaggggaaaattgtcgacttgttttcagggctggatagcccagccatcctcgtcctggtcaactatatcttcttcaaaggcacatggacacagccctttgacctggcaagcaccagggaggagaacttctatgtggacgagacaactgtggtgaaggtgcccatgatgttgcagtcgagcaccatcagttaccttcatgacgcggagctcccctgccagctggtgcagatgaactacgtgggcaatgggactgtcttcttcatccttccggacaaggggaagatgaacacagtcatcgctgcactgagccgggacacgattaacaggtggtccgcaggcctgaccagcagccaggtggacctgtacattccaaaggtcaccatctctggagtctatgacctcggagatgtgctggaggaaatgggcattgcagacttgttcaccaaccaggcaaatttctcacgcatcacccaggacgcccagctgaagtcatcaaaggtggtccataaagctgtgctgcaactcaatgaggagggtgtggacacagctggctccactggggtcaccctaaacctgacgtccaagcctatcatcttgcgtttcaaccagcccttcatcatcatgatcttcgaccacttcacctggagcagccttttcctggcgagggttatgaacccagtgtaa
Sequence Length
1218
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
866
Molecular Weight
45,141 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6, mRNA
NCBI Official Synonym Full Names
serpin family A member 6
NCBI Official Symbol
SERPINA6
NCBI Official Synonym Symbols
CBG
NCBI Protein Information
corticosteroid-binding globulin
UniProt Protein Name
Corticosteroid-binding globulin
Protein Family
UniProt Gene Name
SERPINA6
UniProt Synonym Gene Names
CBG; CBG
UniProt Entry Name
CBG_HUMAN

NCBI Description

This gene encodes an alpha-globulin protein with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors which may have evolved by duplication events. [provided by RefSeq, Jul 2008]

Uniprot Description

SERPINA6: Major transport protein for glucocorticoids and progestins in the blood of almost all vertebrate species. Defects in SERPINA6 are a cause of corticosteroid-binding globulin deficiency (CBG deficiency). CBG deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo/hypertension and muscle fatigue. Belongs to the serpin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q32.1

Cellular Component: extracellular space

Molecular Function: serine-type endopeptidase inhibitor activity; steroid binding

Disease: Corticosteroid-binding Globulin Deficiency

Research Articles on SERPINA6

Similar Products

Product Notes

The SERPINA6 serpina6 (Catalog #AAA1272975) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactcc tcctgtacac ctgtcttctc tggctgccca ccagcggcct ctggaccgtc caggccatgg atcctaacgc tgcttatgtg aacatgagta accatcaccg gggcctggct tcagccaacg ttgactttgc cttcagcctg tataagcacc tagtggcctt gagtcccaaa aagaacattt tcatctcccc tgtgagcatc tccatggcct tagctatgct gtccctgggc acctgtggcc acacacgggc ccagcttctc cagggcctgg gtttcaacct cactgagagg tctgagactg agatccacca gggtttccag cacctgcacc aactctttgc aaagtcagac accagcttag aaatgaccat gggcaatgcc ttgtttcttg atggcagcct ggagttgctg gagtcattct cagcagacat caagcactac tatgagtcag aggtcttggc tatgaatttc caggactggg caacagccag cagacagatc aacagctatg tcaagaataa gacacagggg aaaattgtcg acttgttttc agggctggat agcccagcca tcctcgtcct ggtcaactat atcttcttca aaggcacatg gacacagccc tttgacctgg caagcaccag ggaggagaac ttctatgtgg acgagacaac tgtggtgaag gtgcccatga tgttgcagtc gagcaccatc agttaccttc atgacgcgga gctcccctgc cagctggtgc agatgaacta cgtgggcaat gggactgtct tcttcatcct tccggacaag gggaagatga acacagtcat cgctgcactg agccgggaca cgattaacag gtggtccgca ggcctgacca gcagccaggt ggacctgtac attccaaagg tcaccatctc tggagtctat gacctcggag atgtgctgga ggaaatgggc attgcagact tgttcaccaa ccaggcaaat ttctcacgca tcacccagga cgcccagctg aagtcatcaa aggtggtcca taaagctgtg ctgcaactca atgaggaggg tgtggacaca gctggctcca ctggggtcac cctaaacctg acgtccaagc ctatcatctt gcgtttcaac cagcccttca tcatcatgat cttcgaccac ttcacctgga gcagcctttt cctggcgagg gttatgaacc cagtgtaa. It is sometimes possible for the material contained within the vial of "SERPINA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.