Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL17 cdna clone

KLHL17 cDNA Clone

Synonyms
KLHL17; KLHL17 cDNA Clone; KLHL17 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgagagccgccagacccacgtgacgctgcacgacatcgaccctcaggccttggaccagctggtgcagtttgcctacacggctgagattgtggtgggcgagggcaatgtgcagactctgctcccagccgccagtctcctgcagctgaatggcgtccgagacgcttgctgcaagtttctactgagtcagctcgacccctccaactgcctgggtatccggggctttgccgatgcccactcctgcagcgacctgctcaaggccgcccacaggtacgtgctgcagcacttcgtggacgtggccaagaccgaggagtttatgctgctgcccctgaaacaggtaacagctggcgggcccagccctcgccccccaccccaccccaccccagtctttgtctttgactcccgaccccgttttgttcctgacacagccctgcccacaatccttagtgcctgctgtgtgtccccgagaccttcctggatctgggccccccaggagcctcgtctgtggctcctgactctgctcggcccctcccagtatgaacactcagcccccacctgctaa
Sequence Length
564
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,874 Da
NCBI Official Full Name
Homo sapiens kelch-like 17 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 17
NCBI Official Symbol
KLHL17
NCBI Protein Information
kelch-like protein 17
UniProt Protein Name
Kelch-like protein 17
Protein Family
UniProt Gene Name
KLHL17
UniProt Entry Name
KLH17_HUMAN

NCBI Description

The protein encoded by this gene is expressed in neurons of most regions of the brain. It contains an N-terminal BTB domain, which mediates dimerization of the protein, and a C-terminal Kelch domain, which mediates binding to F-actin. This protein may play a key role in the regulation of actin-based neuronal function. [provided by RefSeq, Aug 2010]

Uniprot Description

Actinfilin: Substrate-recognition component of some cullin-RING- based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex. The BCR(KLHL17) mediates the ubiquitination and subsequenct degradation of GLUR6. May play a role in the actin-based neuronal function.

Protein type: Actin-binding; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1p36.33

Cellular Component: actin cytoskeleton; dendrite cytoplasm; extracellular space

Molecular Function: actin filament binding; protein complex scaffold; ubiquitin-protein ligase activity

Biological Process: actin cytoskeleton organization and biogenesis; brain development

Similar Products

Product Notes

The KLHL17 klhl17 (Catalog #AAA1272959) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgaga gccgccagac ccacgtgacg ctgcacgaca tcgaccctca ggccttggac cagctggtgc agtttgccta cacggctgag attgtggtgg gcgagggcaa tgtgcagact ctgctcccag ccgccagtct cctgcagctg aatggcgtcc gagacgcttg ctgcaagttt ctactgagtc agctcgaccc ctccaactgc ctgggtatcc ggggctttgc cgatgcccac tcctgcagcg acctgctcaa ggccgcccac aggtacgtgc tgcagcactt cgtggacgtg gccaagaccg aggagtttat gctgctgccc ctgaaacagg taacagctgg cgggcccagc cctcgccccc caccccaccc caccccagtc tttgtctttg actcccgacc ccgttttgtt cctgacacag ccctgcccac aatccttagt gcctgctgtg tgtccccgag accttcctgg atctgggccc cccaggagcc tcgtctgtgg ctcctgactc tgctcggccc ctcccagtat gaacactcag cccccacctg ctaa. It is sometimes possible for the material contained within the vial of "KLHL17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.