Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AHDC1 cdna clone

AHDC1 cDNA Clone

Gene Names
AHDC1; MRD25
Synonyms
AHDC1; AHDC1 cDNA Clone; AHDC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggactggaacgaggcatcatctgcccccggctacaactggaaccagagtgtcctctttcagagtagctccaagccgggccgtggacggcggaagaaggtggacctgttcgaggcctcacatctgggcttcccgacatccgcctctgccgctgcctcaggctacccatccaaacggagcactgggccccggcagccgcgaggtggacggggcggtggggcctgctcagccaagaaggagcggggtggcgcagcggccaaagccaagttcatccccaagccacagccagtcaacccactgttccaggacagtcctgacctcggcctggactactatagcggggacagcagcatgtcaccactgccctcacagtcgagggccttcggcgtgggagagcgagacccctgtgacttcataggaccctactccatgaacccgtccacgccttccgatggcacctttggccaaggcttccactgcgactcgcccagcctgggtgctcccgagcttgatggcaagcatttcccaccgctggcccacccacccacggtgtttgacgccggcctgcagaaggcatactcgcccacctgctcgcctacactgggcttcaaggaagagctgcggccaccgcccacaaagctggctgcctgcgagcccctcaagcatggactccagggggccagcctgggccacgcagctgcagcccaggcccacctgagctgccgggacctgccgctgggccagccccactacgattcccccagctgcaagggcacagcctattggtaccctccaggctcagctgcccgcagcccgccctatgaaggcaaggtgggtacagggctgctggctgacttcctgggcaggacggaggccgcgtgcctcagtgcccctcacctggctagcccaccagccacgcccaaggccgacaaggagccactggaaatggcccggccccctggcccaccccgtggccctgctgcagccgctgctggctatggctgcccactccttagtgacttgaccctgtcccccgtgccgagggactcgctgctgcccctgcaggacaccgcctacaggtacccaggctttatgccccaggcgcatcctggcctgggtgggggccccaagagcggcttcctggggcccatggcggaacctcaccccgaggacacattcaccgtcacatccctgtag
Sequence Length
1200
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
168,349 Da
NCBI Official Full Name
Homo sapiens AT hook, DNA binding motif, containing 1, mRNA
NCBI Official Synonym Full Names
AT-hook DNA binding motif containing 1
NCBI Official Symbol
AHDC1
NCBI Official Synonym Symbols
MRD25
NCBI Protein Information
AT-hook DNA-binding motif-containing protein 1
UniProt Protein Name
AT-hook DNA-binding motif-containing protein 1
UniProt Gene Name
AHDC1
UniProt Entry Name
AHDC1_HUMAN

NCBI Description

This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]

Uniprot Description

AHDC1:

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 1p36.13

Disease: Xia-gibbs Syndrome

Research Articles on AHDC1

Similar Products

Product Notes

The AHDC1 ahdc1 (Catalog #AAA1272917) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggact ggaacgaggc atcatctgcc cccggctaca actggaacca gagtgtcctc tttcagagta gctccaagcc gggccgtgga cggcggaaga aggtggacct gttcgaggcc tcacatctgg gcttcccgac atccgcctct gccgctgcct caggctaccc atccaaacgg agcactgggc cccggcagcc gcgaggtgga cggggcggtg gggcctgctc agccaagaag gagcggggtg gcgcagcggc caaagccaag ttcatcccca agccacagcc agtcaaccca ctgttccagg acagtcctga cctcggcctg gactactata gcggggacag cagcatgtca ccactgccct cacagtcgag ggccttcggc gtgggagagc gagacccctg tgacttcata ggaccctact ccatgaaccc gtccacgcct tccgatggca cctttggcca aggcttccac tgcgactcgc ccagcctggg tgctcccgag cttgatggca agcatttccc accgctggcc cacccaccca cggtgtttga cgccggcctg cagaaggcat actcgcccac ctgctcgcct acactgggct tcaaggaaga gctgcggcca ccgcccacaa agctggctgc ctgcgagccc ctcaagcatg gactccaggg ggccagcctg ggccacgcag ctgcagccca ggcccacctg agctgccggg acctgccgct gggccagccc cactacgatt cccccagctg caagggcaca gcctattggt accctccagg ctcagctgcc cgcagcccgc cctatgaagg caaggtgggt acagggctgc tggctgactt cctgggcagg acggaggccg cgtgcctcag tgcccctcac ctggctagcc caccagccac gcccaaggcc gacaaggagc cactggaaat ggcccggccc cctggcccac cccgtggccc tgctgcagcc gctgctggct atggctgccc actccttagt gacttgaccc tgtcccccgt gccgagggac tcgctgctgc ccctgcagga caccgcctac aggtacccag gctttatgcc ccaggcgcat cctggcctgg gtgggggccc caagagcggc ttcctggggc ccatggcgga acctcacccc gaggacacat tcaccgtcac atccctgtag. It is sometimes possible for the material contained within the vial of "AHDC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.