TMEM59L cdna clone
TMEM59L cDNA Clone
Gene Names
TMEM59L; BSMAP; C19orf4
Synonyms
TMEM59L; TMEM59L cDNA Clone; TMEM59L cdna clone
Sequence
atggctgcggtggcgctgatgccaccgccgctgctgctgctgctgctgttggcgtcgccgcccgccgcctccgcgccgtccgcccgcgatcccttcgccccccagctcggggacacgcagaactgccagctgcggtgccgcgaccgcgacctcggcccgcagccctcgcaggcggggctggagggcgcctccgagtctccctatgacagagccgttctgatcagcgcttgcgagcgtggctgccgcctcttctccatctgccgatttgtggccagaagctccaagcccaatgccacccaaactgagtgtgaagcagcctgcgtggaagcctatgtgaaggaggcagagcagcaggcctgtagccacggctgctggagccagcccgcggagcctgagccggagcagaagagaaaggtcctggaggctccaagtggggccctctccctcttggacttgttttccaccctctgcaatgacctcgtcaactcagcccagggatttgtctcctccacctggacatactacttgcagactgacaatgggaaagtggtggtgtttcagactcagcccatagtggagagcctcggcttccaggggggccgtctgcagcgcgtggaggtgacctggcgaggctcccaccctgaagccctggaggtgcacgtggaccctgtaggccccctggacaaggtgaggaaggccaagatccgagtcaagaccagcagcaaggccaaggtggagtctgaagagccacaggacaatgacttcctcagttgcatgtcccggcgctcgggtctgcctcgctggatcctggcctgctgcctcttcctctccgtgctggtgatgctgtggctgagctgctccaccctggtgaccgcgcctggccagcacctcaagttccagcctctgaccctggagcagcacaagggcttcatgatggagcccgattggcccctgtacccgccgccgtcccacgcctgtgaggacagcctaccaccctacaagctgaagctggacctgaccaagctgtag
Sequence Length
1029
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,619 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 59-like, mRNA
NCBI Official Synonym Full Names
transmembrane protein 59 like
NCBI Official Symbol
TMEM59L
NCBI Official Synonym Symbols
BSMAP; C19orf4
NCBI Protein Information
transmembrane protein 59-like
UniProt Protein Name
Transmembrane protein 59-like
Protein Family
UniProt Gene Name
TMEM59L
UniProt Synonym Gene Names
BSMAP; C19orf4
UniProt Entry Name
TM59L_HUMAN
NCBI Description
This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Uniprot Description
TMEM59L: Modulates the O-glycosylation and complex N- glycosylation steps occurring during the Golgi maturation of APP. Inhibits APP transport to the cell surface and further shedding. Belongs to the TMEM59 family.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 19p12
Cellular Component: membrane
Similar Products
Product Notes
The TMEM59L tmem59l (Catalog #AAA1272719) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgg tggcgctgat gccaccgccg ctgctgctgc tgctgctgtt ggcgtcgccg cccgccgcct ccgcgccgtc cgcccgcgat cccttcgccc cccagctcgg ggacacgcag aactgccagc tgcggtgccg cgaccgcgac ctcggcccgc agccctcgca ggcggggctg gagggcgcct ccgagtctcc ctatgacaga gccgttctga tcagcgcttg cgagcgtggc tgccgcctct tctccatctg ccgatttgtg gccagaagct ccaagcccaa tgccacccaa actgagtgtg aagcagcctg cgtggaagcc tatgtgaagg aggcagagca gcaggcctgt agccacggct gctggagcca gcccgcggag cctgagccgg agcagaagag aaaggtcctg gaggctccaa gtggggccct ctccctcttg gacttgtttt ccaccctctg caatgacctc gtcaactcag cccagggatt tgtctcctcc acctggacat actacttgca gactgacaat gggaaagtgg tggtgtttca gactcagccc atagtggaga gcctcggctt ccaggggggc cgtctgcagc gcgtggaggt gacctggcga ggctcccacc ctgaagccct ggaggtgcac gtggaccctg taggccccct ggacaaggtg aggaaggcca agatccgagt caagaccagc agcaaggcca aggtggagtc tgaagagcca caggacaatg acttcctcag ttgcatgtcc cggcgctcgg gtctgcctcg ctggatcctg gcctgctgcc tcttcctctc cgtgctggtg atgctgtggc tgagctgctc caccctggtg accgcgcctg gccagcacct caagttccag cctctgaccc tggagcagca caagggcttc atgatggagc ccgattggcc cctgtacccg ccgccgtccc acgcctgtga ggacagccta ccaccctaca agctgaagct ggacctgacc aagctgtag. It is sometimes possible for the material contained within the vial of "TMEM59L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
