VILL cdna clone
VILL cDNA Clone
Synonyms
VILL; VILL cDNA Clone; VILL cdna clone
Sequence
atgatgattcagtggaatgggcccaagaccagcatttctgagaaggctcgggggctggctttgacctacagcctccgggacagggaacgtggtggtggtcgtgcacagattggtgtggtggatgatgaggccaaagccccggacctcatgcagatcatggaggctgtgctgggccgcagggtgggcagcctgcgtgccgccacgcccagcaaggatatcaaccagctgcagaaggccaatgttcgcctgtaccatgtctatgagaagggcaaagacctggtggtcctggagttggcgacccccccactgacccaggacctgctgcaggaggaggacttctacatcctggaccagggtggcttcaagatctatgtgtggcagggacgcatgtctagcctccaggagagaaaggctgccttcagccgggctgtgggcttcatccaggccaagggctacccgacctacaccaacgtggaggtggtgaacgacggcgccgagtcggccgcgttcaagcagctcttccggacttggtctgagaagcggcgcaggaaccagaagctcggcgggagggataaatcgattcatgtaaagctggacgtgggcaagctgcacacccagcctaagttagcggcccagctcaggatggtggacgacggctctgggaaggtggaggtgtggtgcatccaggacttacacaggcagcccgtggaccccaagcgtcatggacagctgtgtgcaggcaactgctaccttgtgctctacacataccagaggctgggccgtgtccagtacatcctgtacctatggcagggccaccaggccactgcggatgagattgaggccctgaacagcaacgctgaggaactagatgtcatgtatggtggcgtcctagtacaggagcatgtgaccatgggcagcgagcccccccacttcctcgccatcttccagggccagctggtgatcttccaggagagagctgggcaccatggaaaggggcagtcagcatccaccacaaggcttttccaagtgcaaggcactgacagccacaacaccaggaccatggaggtgccagcccgtgcctcatccctcaactccagtgacatcttcttgctggtcacagccagcgtctgctacctctggtttgggaagggctgtaatggtgatcagcgtgagatggcacgggtggtggtcactgtcatttccaggaagaatgaggaaacggtgctggagggtcaggagcctccccacttctgggaggccctgggaggccgggccccctaccccagcaacaagaggctccctgaggaggtccccagcttccagccacgactgtttgagtgctccagccacatgggctgcctggtcctcgcagaagtggggttcttcagccaggaggacctggacaagtatgacatcatgttactggacacctggcaggagatcttcctgtggcttggggaagctgcaagtgagtggaaggaggcggtggcctggggccaggagtacctgaagactcacccagcagggaggagcccggccacacccatcgtgctggtcaagcagggccatgagcctcccaccttcattggatggttcttcacttgggacccctacaagtggactagccacccgtcccacaaggaagtggtggatggcagcccggcagcagcatcaaccatctctgagataacagcagaagtcaacaacttgcggctatccagatggccgggcaatggcagggcaggtgccgtggccctgcaggccctcaagggctcccaggacagctcagagaatgatctggtgcgaagccccaagtcggctggcagcagaaccagcagctccgtcagcagcaccagcgccacgatcaacggtggcctgcgccgggaacaactgatgcaccaggctgttgaggacctgccagagggcgtggaccctgcccgcagggagttctatctctcagactctgacttccaagatatctttgggaaatccaaggaggaattctacagcatggccacgtggaggcagcggcaggagaaaaagcagctgggcttcttctga
Sequence Length
2061
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
94,417 Da
NCBI Official Full Name
Homo sapiens villin-like, mRNA
NCBI Official Synonym Full Names
villin like
NCBI Official Symbol
VILL
NCBI Protein Information
villin-like protein
UniProt Protein Name
Villin-like protein
Protein Family
UniProt Gene Name
VILL
UniProt Entry Name
VILL_HUMAN
NCBI Description
The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Uniprot Description
VILL: Possible tumor suppressor. Belongs to the villin/gelsolin family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 3p21.3
Cellular Component: actin cytoskeleton
Molecular Function: structural constituent of cytoskeleton
Research Articles on VILL
Similar Products
Product Notes
The VILL vill (Catalog #AAA1272682) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgattc agtggaatgg gcccaagacc agcatttctg agaaggctcg ggggctggct ttgacctaca gcctccggga cagggaacgt ggtggtggtc gtgcacagat tggtgtggtg gatgatgagg ccaaagcccc ggacctcatg cagatcatgg aggctgtgct gggccgcagg gtgggcagcc tgcgtgccgc cacgcccagc aaggatatca accagctgca gaaggccaat gttcgcctgt accatgtcta tgagaagggc aaagacctgg tggtcctgga gttggcgacc cccccactga cccaggacct gctgcaggag gaggacttct acatcctgga ccagggtggc ttcaagatct atgtgtggca gggacgcatg tctagcctcc aggagagaaa ggctgccttc agccgggctg tgggcttcat ccaggccaag ggctacccga cctacaccaa cgtggaggtg gtgaacgacg gcgccgagtc ggccgcgttc aagcagctct tccggacttg gtctgagaag cggcgcagga accagaagct cggcgggagg gataaatcga ttcatgtaaa gctggacgtg ggcaagctgc acacccagcc taagttagcg gcccagctca ggatggtgga cgacggctct gggaaggtgg aggtgtggtg catccaggac ttacacaggc agcccgtgga ccccaagcgt catggacagc tgtgtgcagg caactgctac cttgtgctct acacatacca gaggctgggc cgtgtccagt acatcctgta cctatggcag ggccaccagg ccactgcgga tgagattgag gccctgaaca gcaacgctga ggaactagat gtcatgtatg gtggcgtcct agtacaggag catgtgacca tgggcagcga gcccccccac ttcctcgcca tcttccaggg ccagctggtg atcttccagg agagagctgg gcaccatgga aaggggcagt cagcatccac cacaaggctt ttccaagtgc aaggcactga cagccacaac accaggacca tggaggtgcc agcccgtgcc tcatccctca actccagtga catcttcttg ctggtcacag ccagcgtctg ctacctctgg tttgggaagg gctgtaatgg tgatcagcgt gagatggcac gggtggtggt cactgtcatt tccaggaaga atgaggaaac ggtgctggag ggtcaggagc ctccccactt ctgggaggcc ctgggaggcc gggcccccta ccccagcaac aagaggctcc ctgaggaggt ccccagcttc cagccacgac tgtttgagtg ctccagccac atgggctgcc tggtcctcgc agaagtgggg ttcttcagcc aggaggacct ggacaagtat gacatcatgt tactggacac ctggcaggag atcttcctgt ggcttgggga agctgcaagt gagtggaagg aggcggtggc ctggggccag gagtacctga agactcaccc agcagggagg agcccggcca cacccatcgt gctggtcaag cagggccatg agcctcccac cttcattgga tggttcttca cttgggaccc ctacaagtgg actagccacc cgtcccacaa ggaagtggtg gatggcagcc cggcagcagc atcaaccatc tctgagataa cagcagaagt caacaacttg cggctatcca gatggccggg caatggcagg gcaggtgccg tggccctgca ggccctcaag ggctcccagg acagctcaga gaatgatctg gtgcgaagcc ccaagtcggc tggcagcaga accagcagct ccgtcagcag caccagcgcc acgatcaacg gtggcctgcg ccgggaacaa ctgatgcacc aggctgttga ggacctgcca gagggcgtgg accctgcccg cagggagttc tatctctcag actctgactt ccaagatatc tttgggaaat ccaaggagga attctacagc atggccacgt ggaggcagcg gcaggagaaa aagcagctgg gcttcttctg a. It is sometimes possible for the material contained within the vial of "VILL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
