Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP2K7 cdna clone

MAP2K7 cDNA Clone

Gene Names
MAP2K7; MEK; MKK7; JNKK2; MEK 7; MAPKK7; PRKMK7; SAPKK4; SAPKK-4
Synonyms
MAP2K7; MAP2K7 cDNA Clone; MAP2K7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgtcctccctggaacagaagctgtcccgcctggaagcaaagctaaagcaggagaaccgggaggcccggcggaggatcgacctcaacctggatatcagcccccagcggcccaggcccaccctgcagctcccgctggccaacgatgggggcagccgctcgccatcctcagagagctccccgcagcaccccacgccccccgcccggccccgccacatgctggggctcccgtcaaccctgttcacaccccgcagcatggagagcattgagattgaccagaagctgcaggagatcatgaagcagacgggctacctgaccatcgggggccagcgctaccaggcagaaatcaacgacctggagaacttgggcgagatgggcagcggcacctgcggccaggtgtggaagatgcgcttccggaagaccggccacgtcattgccgttaagcaaatgcggcgctccgggaacaaggaggagaacaagcgcatcctcatggacctggatgtggtgctgaagagccacgactgcccctacatcgtgcagtgctttgggacgttcatcaccaacacggatgtcttcatcgccatggagctcatgggcacctgcgctgagaagctcaagaagcggatgcagggccccatccccgagcgcattctgggcaagatgacagtggcgattgtgaaggcgctgtactacctgaaggagaagcacggtgtcatccaccgcgacgtcaagccctccaacatcctgctggacgagcggggccagatcaagctctgcgacttcggcatcagcggccgcctggtggactccaaagccaagacgcggagcgccggctgtgccgcctacatggcacccgagcgcattgaccccccagaccccaccaagccggactatgacatccgggccgacgtatggagcctgggcatctcgttgccctgcccgtctccctcccaggtggagctggcaacaggacagtttccctacaagaactgcaagacggactttgaggtcctcaccaaagtcctacaggaagagcccccgcttctgcccggacacatgggcttctcgggggacttccagtccttcgtcaaagactgccttactaaagatcacaggaagagaccaaagtataataagctacttgaacacagcttcatcaagcgctacgagacgctggaggtggacgtggcgtcctggttcaaggatgtcatggcgaagactgagtcaccgcggactagcggcgtcctgagccagccccacctgcccttcttcaggtag
Sequence Length
1281
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,182 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase 7, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase 7
NCBI Official Symbol
MAP2K7
NCBI Official Synonym Symbols
MEK; MKK7; JNKK2; MEK 7; MAPKK7; PRKMK7; SAPKK4; SAPKK-4
NCBI Protein Information
dual specificity mitogen-activated protein kinase kinase 7
UniProt Protein Name
Dual specificity mitogen-activated protein kinase kinase 7
UniProt Gene Name
MAP2K7
UniProt Synonym Gene Names
JNKK2; MEK7; MKK7; PRKMK7; SKK4; MAP kinase kinase 7; MAPKK 7; MEK 7; SAPK kinase 4; SAPKK-4; SAPKK4; JNK kinase 2; JNKK 2
UniProt Entry Name
MP2K7_HUMAN

NCBI Description

The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell responses to proinflammatory cytokines, and environmental stresses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

MKK7: a dual-specificity protein kinase of the STE7 family. Activates JNK1 and -2 by phosphorylating a Thr and a Tyr residue in the activation loop. Is activated by proinflammatory cytokines and environmental stress. Three alternatively spliced isoforms have been reported.

Protein type: Kinase, protein; EC 2.7.12.2; Protein kinase, STE; Protein kinase, dual-specificity (non-receptor); STE group; STE7 family

Chromosomal Location of Human Ortholog: 19p13.3-p13.2

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: enzyme binding; magnesium ion binding; MAP kinase kinase activity; protein binding; protein kinase binding; protein phosphatase binding; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of JNK activity; JNK cascade; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; response to heat; response to osmotic stress; response to UV; signal transduction; stress-activated MAPK cascade

Research Articles on MAP2K7

Similar Products

Product Notes

The MAP2K7 map2k7 (Catalog #AAA1272678) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgt cctccctgga acagaagctg tcccgcctgg aagcaaagct aaagcaggag aaccgggagg cccggcggag gatcgacctc aacctggata tcagccccca gcggcccagg cccaccctgc agctcccgct ggccaacgat gggggcagcc gctcgccatc ctcagagagc tccccgcagc accccacgcc ccccgcccgg ccccgccaca tgctggggct cccgtcaacc ctgttcacac cccgcagcat ggagagcatt gagattgacc agaagctgca ggagatcatg aagcagacgg gctacctgac catcgggggc cagcgctacc aggcagaaat caacgacctg gagaacttgg gcgagatggg cagcggcacc tgcggccagg tgtggaagat gcgcttccgg aagaccggcc acgtcattgc cgttaagcaa atgcggcgct ccgggaacaa ggaggagaac aagcgcatcc tcatggacct ggatgtggtg ctgaagagcc acgactgccc ctacatcgtg cagtgctttg ggacgttcat caccaacacg gatgtcttca tcgccatgga gctcatgggc acctgcgctg agaagctcaa gaagcggatg cagggcccca tccccgagcg cattctgggc aagatgacag tggcgattgt gaaggcgctg tactacctga aggagaagca cggtgtcatc caccgcgacg tcaagccctc caacatcctg ctggacgagc ggggccagat caagctctgc gacttcggca tcagcggccg cctggtggac tccaaagcca agacgcggag cgccggctgt gccgcctaca tggcacccga gcgcattgac cccccagacc ccaccaagcc ggactatgac atccgggccg acgtatggag cctgggcatc tcgttgccct gcccgtctcc ctcccaggtg gagctggcaa caggacagtt tccctacaag aactgcaaga cggactttga ggtcctcacc aaagtcctac aggaagagcc cccgcttctg cccggacaca tgggcttctc gggggacttc cagtccttcg tcaaagactg ccttactaaa gatcacagga agagaccaaa gtataataag ctacttgaac acagcttcat caagcgctac gagacgctgg aggtggacgt ggcgtcctgg ttcaaggatg tcatggcgaa gactgagtca ccgcggacta gcggcgtcct gagccagccc cacctgccct tcttcaggta g. It is sometimes possible for the material contained within the vial of "MAP2K7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.