Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SAA1 cdna clone

SAA1 cDNA Clone

Gene Names
SAA1; SAA; PIG4; SAA2; TP53I4
Synonyms
SAA1; SAA1 cDNA Clone; SAA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcttctcacgggcctggttttctgctccttggtcctgggtgtcagcagccgaagcttcttttcgttccttggcgaggcttttgatggggctcgggacatgtggagagcctactctgacatgagagaagccaattacatcggctcagacaaatacttccatgctcgggggaactatgatgctgccaaaaggggacctgggggtgtctgggctgcagaagcgatcagcgatgccagagagaatatccagagattctttggccatggtgcggaggactcactggccgatcaggctgccgatgaatggggcaggagtggcaaagaccccaatcacttccgacctgctggcctgcctgagaaatactga
Sequence Length
369
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,532 Da
NCBI Official Full Name
Homo sapiens serum amyloid A1, mRNA
NCBI Official Synonym Full Names
serum amyloid A1
NCBI Official Symbol
SAA1
NCBI Official Synonym Symbols
SAA; PIG4; SAA2; TP53I4
NCBI Protein Information
serum amyloid A-1 protein
UniProt Protein Name
Serum amyloid A-1 protein
Protein Family
UniProt Gene Name
SAA1
UniProt Synonym Gene Names
SAA
UniProt Entry Name
SAA1_HUMAN

NCBI Description

This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11. [provided by RefSeq, Feb 2016]

Uniprot Description

SAA1: Major acute phase reactant. Apolipoprotein of the HDL complex. Reactive, secondary amyloidosis is characterized by the extracellular accumulation in various tissues of the SAA1 protein. These deposits are highly insoluble and resistant to proteolysis; they disrupt tissue structure and compromise function. Elevated serum SAA1 protein levels may be associated with lung cancer. Belongs to the SAA family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 11p15.1

Cellular Component: cytoplasmic microtubule; extracellular region; extracellular space

Molecular Function: chemoattractant activity; G-protein-coupled receptor binding

Biological Process: activation of MAPK activity; cellular protein metabolic process; elevation of cytosolic calcium ion concentration; innate immune response; lymphocyte chemotaxis; macrophage chemotaxis; positive regulation of cell adhesion; positive regulation of cytokine secretion; receptor-mediated endocytosis

Research Articles on SAA1

Similar Products

Product Notes

The SAA1 saa1 (Catalog #AAA1272500) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcttc tcacgggcct ggttttctgc tccttggtcc tgggtgtcag cagccgaagc ttcttttcgt tccttggcga ggcttttgat ggggctcggg acatgtggag agcctactct gacatgagag aagccaatta catcggctca gacaaatact tccatgctcg ggggaactat gatgctgcca aaaggggacc tgggggtgtc tgggctgcag aagcgatcag cgatgccaga gagaatatcc agagattctt tggccatggt gcggaggact cactggccga tcaggctgcc gatgaatggg gcaggagtgg caaagacccc aatcacttcc gacctgctgg cctgcctgag aaatactga. It is sometimes possible for the material contained within the vial of "SAA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.