Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CER1 cdna clone

CER1 cDNA Clone

Gene Names
CER1; DAND4
Synonyms
CER1; CER1 cDNA Clone; CER1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatctcctcttatttcagctgctggtactcctgcctctaggaaagaccacacggcaccaggatggccgccagaatcagagttctctttcccccgtactcctgccaaggaatcaaagagagcttcccacaggcaaccatgaggaagctgaggagaagccagatctgtttgtcgcagtgccacaccttgtaggcaccagccctgcaggggaaggccagaggcagagagagaagatgctgtccagatttggcaggttctggaagaagcctgagagagaaatgcatccatccagggactcagatagtgagcccttcccacctgggacccagtccctcatccagccgatagatggaatgaaaatggagaaatctcctcttcgggaagaagccaagaaattctggcaccacttcatgttcagaaaaactccggcttctcagggggtcatcttgcccatcaaaagccatgaagtacattgggagacctgcaggacagtgcccttcagccagactataacccacgaaggctgtgagaaagtagttgttcagaacaacctttgctttgggaaatgcgggtctgttcattttcctggagccgcgcagcactcccatacctcctgctctcactgtttgcctgccaagttcaccacgatgcacttgccagtgaactgcactgaactttcctccgtgatcaaggtggtgatgctggtggaggagtgccagtgcaaggtgaagacggagcatgaagatggacacatcctacatgctggctcccaggattcctttatcccaggagtttcagcttga
Sequence Length
804
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,084 Da
NCBI Official Full Name
Homo sapiens cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), mRNA
NCBI Official Synonym Full Names
cerberus 1, DAN family BMP antagonist
NCBI Official Symbol
CER1
NCBI Official Synonym Symbols
DAND4
NCBI Protein Information
cerberus
UniProt Protein Name
Cerberus
Protein Family
UniProt Gene Name
CER1
UniProt Synonym Gene Names
DAND4
UniProt Entry Name
CER1_HUMAN

NCBI Description

This gene encodes a cytokine member of the cysteine knot superfamily, characterized by nine conserved cysteines and a cysteine knot region. The cerberus-related cytokines, together with Dan and DRM/Gremlin, represent a group of bone morphogenetic protein (BMP) antagonists that can bind directly to BMPs and inhibit their activity. [provided by RefSeq, Jul 2008]

Uniprot Description

CER1: Cytokine that may play a role in anterior neural induction and somite formation during embryogenesis in part through a BMP-inhibitory mechanism. Can regulate Nodal signaling during gastrulation as well as the formation and patterning of the primitive streak. Belongs to the DAN family.

Protein type: Secreted, signal peptide; Secreted; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 9p23-p22

Cellular Component: extracellular region; extracellular space

Molecular Function: morphogen activity; protein homodimerization activity

Biological Process: anterior/posterior axis specification; anterior/posterior pattern formation; BMP signaling pathway; bone mineralization; cell migration involved in gastrulation; determination of dorsal identity; gastrulation; negative regulation of activin receptor signaling pathway; negative regulation of BMP signaling pathway; negative regulation of cell proliferation; negative regulation of Wnt receptor signaling pathway; nervous system development; ureteric bud development

Research Articles on CER1

Similar Products

Product Notes

The CER1 cer1 (Catalog #AAA1272445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatctcc tcttatttca gctgctggta ctcctgcctc taggaaagac cacacggcac caggatggcc gccagaatca gagttctctt tcccccgtac tcctgccaag gaatcaaaga gagcttccca caggcaacca tgaggaagct gaggagaagc cagatctgtt tgtcgcagtg ccacaccttg taggcaccag ccctgcaggg gaaggccaga ggcagagaga gaagatgctg tccagatttg gcaggttctg gaagaagcct gagagagaaa tgcatccatc cagggactca gatagtgagc ccttcccacc tgggacccag tccctcatcc agccgataga tggaatgaaa atggagaaat ctcctcttcg ggaagaagcc aagaaattct ggcaccactt catgttcaga aaaactccgg cttctcaggg ggtcatcttg cccatcaaaa gccatgaagt acattgggag acctgcagga cagtgccctt cagccagact ataacccacg aaggctgtga gaaagtagtt gttcagaaca acctttgctt tgggaaatgc gggtctgttc attttcctgg agccgcgcag cactcccata cctcctgctc tcactgtttg cctgccaagt tcaccacgat gcacttgcca gtgaactgca ctgaactttc ctccgtgatc aaggtggtga tgctggtgga ggagtgccag tgcaaggtga agacggagca tgaagatgga cacatcctac atgctggctc ccaggattcc tttatcccag gagtttcagc ttga. It is sometimes possible for the material contained within the vial of "CER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.